drug trip expression

Top 55 Slang For Drugs Urban Dictionary – Meaning & Usage

Drugs have their own language and culture, with a vast array of slang terms used to describe them. Whether you’re curious about the lingo or simply want to stay informed, this listicle is your ultimate guide to the top slang for drugs , straight from the Urban Dictionary. We’ve done the research so you don’t have to, providing you with an insider’s view into this fascinating world. Stay in the know and expand your knowledge with these eye-opening drug slang terms .

Click above to generate some slangs

A slang term for the drug cannabis, which is derived from the Cannabis plant. It is typically smoked or vaporized for its psychoactive effects. Weed is known for its relaxing and euphoric properties.

For example , “Let’s go smoke some weed and chill.”
In a conversation about drug legalization , someone might argue, “Weed should be legalized for its medicinal benefits.”
A person sharing their experience might say , “I tried weed once and it made me feel really giggly.”

A highly addictive stimulant drug derived from the coca plant. It is typically snorted, injected, or smoked for its intense euphoric effects. Coke is known for its stimulating properties and is illegal in most countries.

For instance , “He got caught with a bag of coke and now he’s facing charges.”
In a discussion about drug abuse , someone might mention, “Coke is one of the most dangerous and addictive drugs.”
A person sharing their experience might say , “I tried coke once at a party and it made me feel invincible.”

A powerful hallucinogenic drug known as lysergic acid diethylamide. Acid is typically taken orally and can cause profound changes in perception, mood, and thought. It is known for its psychedelic effects and can produce intense visual and auditory hallucinations.

For example , “He took a tab of acid and had a mind-bending trip.”
In a conversation about drug experimentation , someone might say, “I’ve always been curious about trying acid.”
A person sharing their experience might describe , “I took acid at a music festival and the colors and sounds were incredible.”

A synthetic psychoactive drug that is chemically similar to both stimulants and hallucinogens. Molly is typically taken orally in the form of a pill or capsule and produces feelings of euphoria, increased empathy, and heightened sensations. It is often associated with electronic dance music (EDM) culture and raves.

For instance , “She took a molly pill and danced all night at the rave.”
In a discussion about party drugs , someone might mention, “Molly is popular among young adults for its euphoric effects.”
A person sharing their experience might say , “I tried molly at a music festival and it made me feel so connected to everyone around me.”

A colloquial term for mushrooms that contain the psychoactive compound psilocybin. Shrooms are typically ingested orally and can cause hallucinations, altered perception, and intense introspective experiences. They are known for their psychedelic effects and are often used for recreational and spiritual purposes.

For example , “We went camping and ate shrooms to have a spiritual journey.”
In a conversation about natural psychedelics , someone might say, “Shrooms have been used for centuries for their mind-altering properties.”
A person sharing their experience might describe , “I tried shrooms with a group of friends and we spent the whole night laughing and exploring our minds.”

Xanax is a prescription medication used to treat anxiety and panic disorders. It belongs to a class of drugs called benzodiazepines. In slang terms, Xanax is often referred to as “bars” due to its bar-shaped appearance.

For example , someone might say, “I took a Xanax to help calm my nerves before the presentation.”
In a discussion about recreational drug use , a person might mention, “Xanax bars are commonly abused for their sedative effects.”
A user might share their experience by saying , “I took a couple of Xanax bars and felt completely relaxed.”

Adderall is a prescription medication used to treat attention deficit hyperactivity disorder (ADHD) and narcolepsy. In slang terms, Adderall is often referred to as “addy”.

For instance , a student might say, “I need to take some addy to help me focus on studying.”
In a conversation about performance-enhancing drugs , someone might mention, “Some athletes misuse addy to improve their athletic performance.”
A person might share their experience by saying , “I took addy before a long day of work and it helped me stay alert and productive.”

Ecstasy, also known as MDMA, is a synthetic psychoactive drug that alters mood and perception. In slang terms, ecstasy is often referred to as “E”.

For example , someone might say, “Let’s go to the rave and drop some E.”
In a discussion about party drugs , a person might mention, “E is known for its euphoric and empathogenic effects.”
A user might share their experience by saying , “I took a pill of E and danced all night at the club.”

Cocaine is a powerful stimulant drug that comes from the leaves of the coca plant. In slang terms, cocaine is often referred to as “blow”.

For instance , someone might say, “He’s addicted to blow and it’s ruining his life.”
In a conversation about drug abuse , a person might mention, “Blow is a highly addictive substance with serious health risks.”
A user might share their experience by saying , “I tried blow once at a party and felt a surge of energy and confidence.”

Heroin is a highly addictive drug derived from morphine, which is extracted from the opium poppy. In slang terms, heroin is often referred to as “dope”.

For example , someone might say, “He got caught with a bag of dope and now he’s facing legal consequences.”
In a discussion about the opioid crisis , a person might mention, “Dope is a dangerous drug that has devastated many communities.”
A user might share their experience by saying , “I struggled with addiction to dope for years before seeking help.”

Speed is a slang term for amphetamine, a central nervous system stimulant that increases alertness and energy levels. It is often used recreationally for its euphoric effects.

For example , someone might say, “I took some speed to help me stay awake and study all night.”
In a discussion about drug abuse , one might mention, “Speed is highly addictive and can have serious health consequences.”
A person sharing their experience might say , “I tried speed once at a party and it made me feel invincible.”

Lucy is a slang term for lysergic acid diethylamide (LSD), a hallucinogenic drug that alters a person’s perception, thoughts, and feelings. It is commonly associated with the counterculture of the 1960s.

For instance , someone might say, “I dropped some Lucy and had the most mind-bending trip.”
In a discussion about psychedelic experiences , one might mention, “Lucy can induce profound spiritual and introspective experiences.”
A person sharing a cautionary tale might say , “I took too much Lucy once and it was a terrifying experience.”

Roxy is a slang term for Roxicodone, a brand name for the prescription opioid painkiller oxycodone. It is commonly abused for its euphoric effects and can lead to dependence and addiction.

For example , someone might say, “I scored some Roxy on the street to help with my pain.”
In a discussion about the opioid crisis , one might mention, “Roxy is a highly abused drug that has contributed to the rise in overdose deaths.”
A person sharing their struggle with addiction might say , “I used to be hooked on Roxy, but I’ve been in recovery for three years now.”

Lean is a slang term for a recreational drug cocktail that contains prescription-strength cough syrup, typically containing codeine and promethazine, mixed with a soft drink and sometimes a hard candy. It produces a sedative and euphoric effect when consumed in large quantities.

For instance , someone might say, “I’m sipping on some lean to help me relax.”
In a discussion about drug culture , one might mention, “Lean has gained popularity in hip hop and rap music.”
A person sharing their experience might say , “I tried lean once and it made me feel numb and disconnected from reality.”

K is a slang term for ketamine, a dissociative anesthetic that is used legally as a veterinary tranquilizer but is also abused recreationally for its hallucinogenic effects. It is often referred to as “Special K” or simply “K”.

For example , someone might say, “I took some K at a music festival and had an out-of-body experience.”
In a discussion about party drugs , one might mention, “K is known for its ability to induce a dream-like state.”
A person sharing their perspective might say , “I’ve seen the negative effects of K abuse firsthand, and it’s not worth the risk.”

“Ice” is a slang term for methamphetamine, a highly addictive stimulant drug. It usually comes in the form of a crystalline powder or small crystals that resemble ice.

For example , a person might say, “He got caught with a bag of ice in his pocket.”
In a discussion about drug addiction , someone might mention, “Ice is one of the most dangerous and destructive drugs.”
A news report might state , “Law enforcement confiscated a large amount of ice during a drug bust.”

“H” is a commonly used abbreviation for heroin, a highly addictive opioid drug derived from morphine. It is typically sold as a white or brown powder, or as a sticky black substance known as “black tar heroin.”

For instance , someone might say, “He was arrested for possession of H.”
In a conversation about the opioid epidemic , a person might comment, “H is ruining lives and communities.”
A news article might report , “The police seized a significant amount of H during a drug raid.”

Crack is a form of cocaine that has been processed into a rock crystal and is typically smoked. It is a highly addictive and potent stimulant drug that produces a short but intense high.

For example , someone might say, “He was addicted to crack for many years.”
In a discussion about drug abuse , a person might mention, “Crack cocaine is a major problem in inner cities.”
A news segment might report , “Authorities arrested several individuals involved in a crack cocaine distribution ring.”

19. Molly water

“Molly water” refers to a mixture of the drug MDMA (commonly known as “Molly” or “Ecstasy”) and water. It is typically consumed orally and is believed to enhance the effects of MDMA.

For instance , a person might say, “I made some molly water for the party.”
In a conversation about party drugs , someone might mention, “Molly water is becoming increasingly popular.”
A blog post might provide a recipe for making molly water at home.

“XTC” is a common abbreviation for the drug ecstasy, which is a psychoactive stimulant that produces feelings of euphoria and heightened sensory perception. It is typically sold in tablet form and often contains MDMA as its active ingredient.

For example , someone might say, “He took a pill of XTC at the rave.”
In a discussion about club drugs , a person might comment, “XTC is known for its energizing and empathogenic effects.”
A news article might report , “Law enforcement seized a large shipment of XTC pills at the border.”

21. Mary Jane

This term is a common slang for marijuana, a psychoactive drug derived from the Cannabis plant. It is often used to refer to the dried flowers, leaves, stems, and seeds of the plant that are typically smoked or consumed for their intoxicating effects.

For example , “Let’s light up some Mary Jane and chill.”
A person discussing the legalization of marijuana might say , “I believe that Mary Jane should be legal for recreational use.”
In a conversation about different strains of marijuana , someone might mention, “I prefer the uplifting effects of Sativa-dominant Mary Jane.”

This term refers to the drug MDMA (3,4-Methylenedioxymethamphetamine), which is commonly known as ecstasy. Ecstasy is a synthetic psychoactive drug that produces feelings of increased energy, euphoria, and empathy. It is often consumed in pill form.

For instance , “Let’s go to the rave and take some X.”
A person describing the effects of ecstasy might say , “X enhances the sensory experience and creates a deep emotional connection with others.”
In a discussion about the dangers of drug use , someone might warn, “Be cautious with X, as it can have negative effects on your mental and physical health.”

This term is a slang for heroin, a highly addictive opioid drug derived from morphine. Heroin is typically sold as a white or brown powder or a black sticky substance known as black tar heroin. It is often injected, smoked, or snorted for its powerful euphoric effects.

For example , “He’s hooked on smack and needs help.”
A person discussing the opioid crisis might say , “Smack is one of the most dangerous and addictive drugs out there.”
In a conversation about the devastating effects of heroin addiction , someone might mention, “I’ve seen firsthand how smack can destroy lives.”

This term is a common slang for cannabis, a psychoactive drug derived from the Cannabis plant. It is often used to refer to the dried flowers, leaves, stems, and seeds of the plant that are typically smoked or consumed for their intoxicating effects.

For instance , “Let’s roll up some pot and relax.”
A person discussing the medical benefits of cannabis might say , “Pot has been proven to alleviate pain and reduce anxiety.”
In a conversation about different strains of marijuana , someone might mention, “I prefer the relaxing effects of Indica-dominant pot.”

25. Acid tabs

This term refers to LSD (Lysergic Acid Diethylamide), a powerful hallucinogenic drug. LSD is commonly sold in the form of small paper squares or “tabs” that are soaked in the drug. When ingested, LSD can cause profound changes in perception, mood, and thought.

For example , “He took two acid tabs and had a mind-bending trip.”
A person describing the effects of LSD might say , “Acid tabs can induce vivid hallucinations and alter your perception of reality.”
In a discussion about the history of psychedelic drugs , someone might mention, “Acid tabs became popular during the counterculture movement of the 1960s.”

26. Xannies

This term refers to Xanax, which is a brand name for the prescription drug alprazolam. Xanax is a benzodiazepine used to treat anxiety and panic disorders. “Xannies” is a slang term used to refer to Xanax pills.

For example , someone might say, “I took a couple of Xannies to help me relax.”
In a discussion about drug use , a person might ask, “Where can I find some Xannies?”
A user might post , “Just had a crazy night with some Xannies. Never again!”

This term is used as slang for the drug MDMA, which is commonly known as ecstasy. “Beans” refers to the shape and color of MDMA pills, which often resemble small beans.

For instance , someone might say, “I’m rolling on beans tonight!”
In a conversation about party drugs , a person might ask, “Have you ever tried beans?”
A user might post , “Just had an amazing night dancing on beans at a music festival.”

In the context of drugs, “trips” refers to psychedelic experiences induced by substances such as LSD or magic mushrooms. These experiences are characterized by hallucinations, altered perception, and profound introspection.

For example , someone might say, “I had the most mind-blowing trip last night!”
In a discussion about drug effects , a person might ask, “What was your most memorable trip?”
A user might post , “Looking for advice on how to navigate a solo trip.”

This term is slang for the drug heroin, which is a highly addictive opioid. “Skag” is a derogatory term commonly used to refer to heroin in urban settings.

For instance , someone might say, “He’s hooked on skag and needs help.”
In a conversation about drug addiction , a person might ask, “How does skag affect the body?”
A user might post , “Stay away from skag. It ruins lives.”

This term is slang for the drug cocaine, which is a powerful stimulant. “Snow” refers to the white, powdery appearance of cocaine.

For example , someone might say, “I’m hitting the slopes tonight and doing some snow.”
In a discussion about drug culture , a person might ask, “Have you ever tried snow?”
A user might post , “Just had a wild night partying on snow. It’s a hell of a drug!”

Bud is a slang term for marijuana, specifically referring to the flower or “bud” of the cannabis plant. It is commonly used to smoke or consume cannabis for its psychoactive effects.

For example , “Let’s go smoke some bud at the park.”
A person might ask , “Do you have any bud? I need to relax.”
In a conversation about different strains of marijuana , someone might say, “I prefer Sativa buds for a more energizing high.”

32. Molly rocks

Molly rocks is a slang term for MDMA crystals, which are a form of the drug MDMA (methylenedioxymethamphetamine). It is commonly used as a party drug for its euphoric and empathogenic effects.

For instance , “I’m going to a rave tonight and planning to take some molly rocks.”
In a discussion about different forms of MDMA , someone might say, “I prefer molly rocks over pressed pills.”
A person might ask , “Where can I find some good molly rocks in this city?”

Tabs is a slang term for LSD blotters, which are small pieces of paper or cardboard soaked in LSD (lysergic acid diethylamide). They are typically placed on the tongue to dissolve and absorb the drug for its hallucinogenic effects.

For example , “I took two tabs of acid last night and had an amazing trip.”
A person might ask , “Do you know where I can get some tabs? I’ve been wanting to try LSD.”
In a conversation about psychedelic experiences , someone might share, “I had a life-changing trip on three tabs of acid.”

34. Speedball

Speedball is a slang term for a combination of heroin and cocaine, typically injected together. The mixture of these two drugs produces a unique and dangerous effect, combining the sedating effects of heroin with the stimulant effects of cocaine.

For instance , “He overdosed on a speedball, mixing heroin and cocaine.”
In a discussion about the dangers of substance abuse , someone might mention, “Speedballing is a highly risky practice.”
A person might ask , “What are the effects of a speedball? I’ve heard it’s intense.”

35. Crystal

Crystal is a slang term for methamphetamine, a highly addictive stimulant drug. It is commonly found in the form of clear crystals or a crystalline powder, hence the name “crystal”.

For example , “He’s addicted to crystal and has been struggling with methamphetamine addiction.”
In a conversation about the dangers of drug use , someone might say, “Crystal is a highly potent and harmful drug.”
A person might ask , “What are the signs of someone using crystal? I suspect a friend might be using methamphetamine.”

36. Dope fiend

This term refers to a person who is addicted to drugs, particularly opiates. It is often used to describe someone who is constantly seeking and using drugs, often to the detriment of their own well-being.

For example , “He used to be such a talented musician, but now he’s just a dope fiend.”
In a discussion about addiction , someone might say, “It’s important to offer support and resources to help dope fiends recover.”
A person sharing a personal story might write , “I was a dope fiend for years before I finally got clean.”

This slang term is often used to refer to marijuana, particularly the plant material itself. It is derived from the color of the plant, which is green.

For instance , “Do you have any green? I need to relax.”
In a conversation about different strains of marijuana , someone might say, “I prefer the effects of the green over the purple.”
A person discussing the legalization of marijuana might argue , “The green industry has the potential to create jobs and stimulate the economy.”

This term is short for methamphetamine, a highly addictive stimulant drug. Meth is known for its powerful and long-lasting effects on the central nervous system.

For example , “He got caught with a bag of meth and now he’s facing serious charges.”
In a discussion about the dangers of drug use , someone might say, “Meth is one of the most destructive drugs out there.”
A person sharing a personal experience might write , “I used to be addicted to meth, but I’ve been clean for three years now.”

This term is short for oxycodone, a potent painkiller that is often prescribed for severe pain. Oxy is a highly addictive drug and is commonly abused.

For instance , “She started taking oxy after her surgery, but now she can’t stop.”
In a conversation about the opioid epidemic , someone might say, “Oxy is one of the most commonly abused prescription drugs.”
A person discussing the dangers of opioid addiction might argue , “Oxy can quickly take over someone’s life and lead to devastating consequences.”

This term is often used to refer to Xanax, a prescription medication used to treat anxiety and panic disorders. Xanax is a benzodiazepine and is known for its sedative effects.

For example , “He took a couple of bars to help him relax before his flight.”
In a discussion about the misuse of prescription drugs , someone might say, “Bars are often abused for their calming effects.”
A person sharing a personal experience might write , “I used to rely on bars to help me sleep, but I’ve since found healthier coping mechanisms.”

Percs is a slang term for the prescription pain medication Percocet. Percocet contains a combination of acetaminophen and oxycodone and is used to treat moderate to severe pain.

For example , someone might say, “I took a couple of Percs to help with my back pain.”
In a discussion about the opioid crisis , one might mention, “Percs are one of the commonly abused prescription drugs.”
A person sharing their experience might say , “I got my wisdom teeth removed and the doctor prescribed Percs for the pain.”

Ganja is a slang term for marijuana, a psychoactive drug derived from the Cannabis plant. It is used for recreational and medicinal purposes.

For instance , someone might say, “Let’s roll up some ganja and have a smoke.”
In a discussion about the legalization of marijuana , one might argue, “Ganja should be legal for both recreational and medicinal use.”
A person sharing their experience might say , “I tried ganja for the first time and it helped me relax and unwind.”

Herb is a slang term for marijuana, derived from the fact that marijuana is a plant. It is commonly used to refer to the dried leaves and flowers of the Cannabis plant that are smoked or consumed for their psychoactive effects.

For example , someone might say, “Pass me that herb, I want to roll a joint.”
In a discussion about different strains of marijuana , one might say, “I prefer smoking sativa herb for its uplifting effects.”
A person sharing their experience might say , “I used to smoke herb regularly, but now I only use it occasionally.”

44. Zannies

Zannies is a slang term for the prescription medication Xanax, which is used to treat anxiety and panic disorders. Xanax belongs to a class of drugs called benzodiazepines and is known for its sedative and calming effects.

For instance , someone might say, “I took a couple of zannies to help me relax before the flight.”
In a discussion about the misuse of prescription drugs , one might mention, “Zannies are commonly abused for their sedative effects.”
A person sharing their experience might say , “I used to rely on zannies to manage my anxiety, but now I’ve found healthier coping mechanisms.”

Skunk is a slang term for a potent strain of marijuana known for its strong smell. It is often used to describe marijuana with a strong and pungent odor.

For example , someone might say, “This skunk is really potent, be prepared for a strong high.”
In a discussion about different strains of marijuana , one might say, “I prefer smoking skunk for its intense aroma and effects.”
A person sharing their experience might say , “I smoked some skunk and it gave me a powerful and euphoric high.”

Blues is a slang term for oxycodone pills, which are a type of prescription opioid painkiller. The term “blues” likely comes from the blue color of the pills, as they are often manufactured in a blue hue.

For example , a person might say, “I’m feeling really sick, I need to take a couple blues to feel better.”
In a discussion about the opioid epidemic , someone might mention, “Blues are highly addictive and can lead to serious health problems.”
A person discussing their struggles with addiction might say , “I used to be hooked on blues, but I’ve been clean for six months now.”

Crank is a slang term for methamphetamine, a highly addictive stimulant drug. The term “crank” is derived from the sound made when methamphetamine is heated and vaporized for inhalation.

For instance , a person might say, “He’s been up for days on a crank binge.”
In a conversation about the dangers of drug use , someone might mention, “Crank can cause severe physical and mental health problems.”
A recovering addict might share their story , saying, “I hit rock bottom when I was addicted to crank, but I’ve turned my life around now.”

Dabs are a slang term for concentrated cannabis products, such as hash oil or wax. These products are made by extracting THC (the psychoactive compound in cannabis) using solvents like butane or CO2.

For example , a person might say, “I prefer dabs over smoking traditional marijuana.”
In a discussion about different methods of consuming cannabis , someone might mention, “Dabs are known for their high potency.”
A cannabis enthusiast might share their experience , saying, “I love the intense effects of dabs, but they’re not for everyone.”

Horse is a slang term for heroin, a highly addictive opioid drug that is typically injected. The term “horse” likely comes from the powerful and fast-acting effects of heroin, which can make the user feel strong and powerful like a horse.

For instance , a person might say, “He’s been struggling with a horse addiction for years.”
In a conversation about the opioid crisis , someone might mention, “Horse is responsible for a significant number of overdose deaths.”
A person in recovery might share their journey , saying, “I never thought I’d be able to break free from the grip of horse, but I’m proud to say I’m sober now.”

Junk is a slang term for heroin, a highly addictive opioid drug. The term “junk” is often used to describe the way heroin addicts may look or behave, as the drug can cause severe physical and mental deterioration.

For example , a person might say, “He’s lost everything to his junk addiction.”
In a discussion about the opioid epidemic , someone might mention, “Junk is destroying communities and ruining lives.”
A person sharing their recovery story might say , “I hit rock bottom when I was deep in my junk addiction, but I’ve been clean for two years now.”

This term is a slang name for marijuana, a psychoactive drug derived from the Cannabis plant. It is commonly used in pop culture references and informal conversations.

For example , “Let’s go smoke some Mary before the concert.”
In a discussion about the legalization of marijuana , someone might say, “I believe Mary should be legal for medicinal purposes.”
A user might post , “Just tried a new strain of Mary and it’s amazing!”

This term is a slang name for cocaine, a powerful stimulant drug that is usually snorted, but can also be smoked, injected, or ingested. It is often referred to as “white” due to its appearance as a white powder.

For instance , someone might say, “He’s always sniffing that white.”
In a conversation about drug abuse , one might mention, “White is a highly addictive substance.”
A user might post , “Just had a wild night on the white!”

This term is a slang name for cocaine, derived from the character Tony Montana’s catchphrase in the movie “Scarface.” It is commonly used in pop culture references and informal conversations.

For example , “Let’s go party and do some yayo.”
In a discussion about the dangers of drug addiction , someone might say, “Yayo can ruin lives.”
A user might post , “Anyone else love the feeling of yayo?”

This term is a slang name for being under the influence of drugs, typically marijuana. It refers to a state of extreme intoxication or being high.

For instance , someone might say, “I smoked so much, I’m completely zooted.”
In a conversation about partying , one might mention, “We got zooted last night.”
A user might post , “Feeling zooted and loving it!”

This term is a slang name for marijuana, a psychoactive drug derived from the Cannabis plant. It is often used to refer to the dried leaves and flowers of the plant.

For example , “Let’s go smoke some grass in the park.”
In a discussion about the benefits of marijuana , someone might say, “Grass can help with pain relief.”
A user might post , “Just got some fresh grass, can’t wait to try it!”

Slang dictionary

Rabbit hole, what does rabbit hole mean.

Used especially in the phrase going down the rabbit hole or falling down the rabbit hole , a rabbit hole is a metaphor for something that transports someone into a wonderfully (or troublingly) surreal state or situation. On the internet, a rabbit hole frequently refers to an extremely engrossing and time-consuming topic.

Where does rabbit hole come from?

Alice falling down a hole with a jar in hand

Literally, a rabbit hole is what the animal digs for its home. The earliest written record of the phrase dates back to the 17th century. But the figurative rabbit hole begins with Lewis Carroll’s 1865 classic, Alice’s Adventures in Wonderland . In its opening chapter, “Down the Rabbit-Hole,” Alice follows the White Rabbit into his burrow, which transports her to the strange, surreal, and nonsensical world of Wonderland.

Since then, Carroll’s rabbit hole has proved a popular and useful reference. The Oxford English Dictionary finds the first allusive rabbit hole in a 1938 edition of The Yale Law Journal : “It is the Rabbit-Hole down which we fell into the Law, and to him who has gone down it, no queer performance is strange.” Over much of the 20th century, rabbit hole has been used to characterize bizarre and irrational experiences. It’s especially used to reference magical, challenging, and even dangerous places or positions, similar to Carroll’s topsy-turvy Wonderland.

Rabbit hole has many metaphorical applications—from frustrating red tape to the mind-bending complexity of science to hallucinations during altered states—all united by a common sense of passing into some labyrinthine , logic-defying realm that, once entered, is hard to get out of. One can fall down the rabbit hole of government bureaucracy, healthcare, obtaining a green card, tax law, the political economy of modern Japan, puberty, college admissions, or quantum mechanics.

If you’re Neo in the hit film The Matrix, you can take the red pill —a pill that shows you the truth, as opposed to the blue pill, which keeps you in ignorance—and “see how deep the rabbit hole goes.” In a related note, some people literally take pills and go down the rabbit hole of a psychedelic drug trip.

But as Kathryn Schulz observed for The New Yorker in 2015, rabbit hole has further evolved in the information age: “These days…when we say that we fell down the rabbit hole, we seldom mean that we wound up somewhere psychedelically strange. We mean that we got interested in something to the point of distraction—usually by accident, and usually to a degree that the subject in question might not seem to merit.”

Thanks to the abundance, variety, and instant access of content online, many fall down internet rabbit holes which are often spectacularly, and addictively, niche: scary stories, obscure conspiracy theories, or famous last meals, for instance.

Other rabbit holes tend to be opened up by specific services or social media, which serve users item after item, link after link: Wikipedia, Netflix, Amazon, Facebook, YouTube, and so forth. These rabbit holes have become so common that people sometimes swap out rabbit for the name of the particular site, e.g. “I’ve fallen down an Instragram hole ” or “I’m falling down a wikihole.”

Examples of rabbit hole

Who uses rabbit hole.

From formal documents to internet status updates, rabbit hole is a very popular and widespread expression. Unlike earlier iterations of the metaphor, internet rabbit holes convey less a sense of weirdness, disorientation, or difficulty than they do of an intensely captivating diversion. Rabbit hole is also showing increasing use as a modifier, e.g. a rabbit-hole question or phenomenon.

This is not meant to be a formal definition of rabbit hole like most terms we define on Dictionary.com, but is rather an informal word summary that hopefully touches upon the key aspects of the meaning and usage of rabbit hole that will help our users expand their word mastery.

By clicking "Sign Up", you are accepting Dictionary.com Terms & Conditions and Privacy policies.
Name This field is for validation purposes and should be left unchanged.

Other categories

Famous People
Fictional Characters
Gender & Sexuality
Historical & Current Events
Pop Culture
Tech & Science
Translations

Supported by

How Does a Writer Put a Drug Trip Into Words?

Share full article

By Michael Pollan

Dec. 24, 2018

Soon after I set out to write a book about psychedelics, it became obvious what I would have to do: Trip, and then write about what it was like. True, I could have relied on the testimony of others, but that seemed less than satisfying. Ever since the 11-year-old me read George Plimpton’s account of playing football in “Paper Lion” (1966), I’ve believed that the most absorbing way to convey an experience is to have it yourself and then try to describe it from the inside. Best of all is to have it yourself for the first time, which is the only time the comprehensive wonder of any experience is available to us.

But while it may have been obvious that I would have to trip in order to write “How to Change Your Mind,” it wasn’t at all obvious how I would write about that experience, one often described as, well, indescribable. William James famously wrote that mystical experience — perhaps the closest analogue we have of a psychedelic trip — is “ineffable”: beyond the reach of language. I couldn’t count on a common frame of reference, since not all of my readers would be familiar with the exotic psychic terrain onto which I wanted to take them. Boring readers was another worry. Perhaps the second closest analogue of a psychedelic journey is the dream, and there is no surer way to drive people off — even your loved ones! — than to tell them your dreams. I’d also read enough “trip reports” online and in books to be acutely aware of the literary risks — what Arthur Koestler, a skeptic after his own psychedelic experiments, described as “pressure-cooker mysticism” and “cosmic schmaltz.”

As I began to write my book, the accounts of my trips loomed up ahead like a range of tall, possibly insurmountable peaks. And matters only got worse when I began having the trips I intended to recount, a series of guided psychedelic journeys on a variety of different chemicals, including LSD, psilocybin, ayahuasca and a substance called 5-MeO-DMT. This last one, which is ingested by smoking the venom of the Sonoran Desert toad, was, I’d been told by a friend, “the Everest of psychedelics,” a trip she promised would obliterate not only all sense of self (as many psychedelics can do) but also all reference points of time and space. How do you possibly construct a narrative without the essential ingredients of person, time and place? What’s left?

Taking notes during my journeys proved futile. I couldn’t summon the will, and the very effort seemed like a violation of my guides’ first commandment, which was to surrender to the experience. So instead I asked them to write down anything I might say. This yielded a handful of mostly useless notes, consisting of vague superlatives like “Spectacular!” or gnomic utterances like “I don’t want to be so stingy with my feelings.” The evening after each journey I spent several hours transcribing everything I could remember, which on psychedelics is a lot. I produced 10 to 15 single-spaced pages in which I tried to render the images, sensations, insights, events and appearances (of people and places) as literally as I could, resisting the urge to interpret, comment, assess or otherwise shape.

When it came time to write the travelogue section of the book, I reread those files with a sinking feeling. Here was a detailed transcript of a stream of consciousness, but a hopelessly anarchic one liable to reverse course without notice, splash wildly, overflow its banks and then simply vanish, circling down a gyre of nothingness. I wasn’t sure I could make sense of its contents, let alone someone less invested in the workings of my mind. I did find some striking images in my notes — being trapped head-to-toe in a black steel cage, watching a vine snake its way up the bars to reach the sun and realizing “a plant can’t be caged” — but what in the world did these images mean, if anything? And some of the profundities I’d recorded in the immediate aftermath of the experience — such as the supreme importance of love, an epiphany I’d had on LSD — now seemed embarrassingly thin, platitudes best suited to a Hallmark card. I was reminded of an experience Oliver Wendell Holmes Sr. had on ether, in which he discovered, and managed to write down, “the one great truth which underlies all human experience.” His notes, which he’d struggled to jot down in his drugged state, read: “A strong smell of turpentine prevails throughout.”

Now, there are two ways to regard such an observation. The first is obvious, at least to our sober selves: as risible proof of the emptiness of chemically mediated “insight.” O.K., fair enough. But might it be worth our while at least to try to imagine a mental state in which the smell of turpentine actually explains something? A state in which all our metaphysical ideas simply dissolve in the presence of overpowering sensory experience? That, it seems to me, is something for which the smell of turpentine is a decent metaphor.

What I realized, reading over my own dubious epiphanies, is that there is an inside and an outside to a psychedelic experience, and that one way to write about it would be to honor both perspectives more or less simultaneously. I wouldn’t take sides, in other words, but would instead attempt to cultivate a measure of intellectual generosity, a kind of negative capability, toward my mental doings, however bizarre, and at the same time frankly acknowledge the reader’s skepticism, which in fact I shared. I would be of two minds. (This is a little like the memoirist, who recounts the naïveté of her younger self from the more knowing perspective of the grown-up author. But here it is not time but type of consciousness that separates the two voices.)

So when I got to my LSD epiphany about the supreme importance of love, following a series of encounters with my wife and son in which I was overwhelmed with gratitude for their existence, I paused in the narrative to reflect on the problem at hand, dilating on the delicate line between profundity and banality. I confessed to the reader that the nakedness of the emotions I was describing, undefended against the pitiless glare of irony, made them embarrassing to write about. Irony was certainly an option, à la Koestler’s cosmic schmaltz. But while irony might have protected me from ridicule, it wouldn’t have been faithful to what I had felt and experienced — which had the power of a revealed truth.

What do you do with an insight like “love is everything”? I wondered aloud. “Is a platitude so deeply felt still just a platitude?” No, I decided: “A platitude is precisely what is left of a truth after it has been drained of all emotion. To resaturate that dried husk with feeling is to see it again for what it is: the loveliest and most deeply rooted of truths, hidden in plain sight.”

So in the end I did take sides, crediting the psychedelic experience rather than my abashed sober self’s take on it, but not before nodding to the reader’s doubts about my reliability (or sanity). Perhaps a more sure-footed writer would have stuck to his psychedelic guns, remaining inside the visionary logic of the experience, but when I tried to write it that way, the narrative lost all friction, making it impossible for anyone but a mystic or psychonaut or ardent New Ager to grab hold of it.

Once I had worked out this double stance, moving back and forth between the interiority of psychedelic consciousness and the ironies of ordinary consciousness, scenes I had approached with dread became great fun to write. For a journalist accustomed to working within the tight box of checkable facts, constructing a narrative from the pure productions of my imagination was liberation itself. I had passed beyond the reach of the fact checker and felt a bit like I imagine a novelist does transcribing her waking dream. Whenever I got to a place in my journey that flirted with implausibility or took me beyond the bounds of grammar or language, I simply turned to the reader, much like an actor breaking the fourth wall, and frankly acknowledged the narrative pickle in which we found ourselves.

Perhaps the trickiest of these passages came during a psilocybin trip when I experienced the complete dissolution of my ego. All at once I had burst into a sheaf of paper slips, no bigger than Post-its, that were being scattered to the wind. Yet there was still an “I” observing this seeming catastrophe, a paradox I couldn’t explain but needed to address.

So who was this other I? “Good question,” I wrote, turning once again to the reader. “It wasn’t me , exactly. Here, the limits of language become a problem: In order to completely make sense of the divide that had opened up in my perspective, I would need a whole new first-person pronoun.” And then, having acknowledged the squishy new terrain of identity onto which we had stepped, I went on to characterize this “bare disembodied awareness, which gazed upon the scene of the self’s dissolution with benign indifference. I was present to reality but as something other than my self. … There was life after the death of the ego. This was big news.”

Multiplying my authorial persona — or was I dividing it? — in this way allowed me to capture at least some of the paradoxicality and sheer weirdness of the psychedelic experience as no single, stable narrator could hope to do. By this point in my story there were three distinct “I’s” telling it: the voyager reporting from inside the experience; the I who observes that first-person poof into Post-its (who is also “inside” the experience but at a remove); and, finally, the “outside” narrator who, acutely aware of just how crazy this all sounds and of the demands he is making of the reader, tries to assure her that it is only the limitations of language that make it hard to see there’s something here worth taking seriously. The acknowledgment of doubt is precisely what allows us to suspend it.

[ Read the review of “How to Change Your Mind” ]

My desire to orient the reader at all is itself a narrative choice, and one that not all writers who’ve attempted to limn the psychedelic experience regard as fair play. The two authors who taught me the most about psychedelic narratives were Aldous Huxley and Henri Michaux. The fact that you’re probably familiar with one and not the other reflects the radically different strategies they employed in their respective books, “The Doors of Perception” and “Miserable Miracle,” both published in the mid-1950s. As it happens, both books are accounts of mescaline trips that the authors took just a few years apart. But there the similarities end.

“The Doors of Perception” is a seamless, confident, elegantly written travelogue of a psychedelic journey that the author found astonishing but entirely comprehensible. Its evocations of an altered state of consciousness are lovely, especially in their visual detail, but on reflection perhaps a tad too lovely: You come away with the feeling that the experience conformed to expectation, and served to illustrate a metaphysics already in place. By the time he wrote the book, Huxley had developed his “perennial philosophy” — the idea that there is a common core of mystical insight at the root of all religions — and his encounter with a divine “Mind at Large” on mescaline confirms him in that belief. His notion that ordinary consciousness functions as a “reducing valve,” a kind of mental filter that restricts our access not only to the divine but to reality as it really is, was not so much inspired as vindicated by the experience. Thus, the chemical flung open the doors of perception, so that when he gazed upon a small vase of flowers, he was able to see “what Adam had seen on the morning of his creation — the miracle, moment by moment, of naked existence.”

To read “The Doors of Perception” is to feel a powerful mind at work, proposing a sturdy set of metaphors — the reducing valve, the mind at large, naked existence, etc. — in order to corral and domesticate the wilds of psychedelic experience. Huxley’s metaphors have influenced all who have followed him; it’s hard to find a trip report written after 1955 that is completely innocent of his interpretation, especially its flavor of Eastern mysticism.

Henri Michaux, the Belgian-born French poet and artist (1899-1984), is a far more esoteric writer, a man allergic to the comforts of certainty — or for that matter, sense. In recounting his mescaline experiences, Michaux took the opposite tack, refusing the offer of metaphor to make sense of an experience he believed was beyond the power of words to convey. In “Miserable Miracle,” he promised to be “attentive to what’s going on — as it is — without trying to deform it and imagine it otherwise in order to make it more interesting to me.” Or more comprehensible to his readers: The book is intermittently brilliant but for long stretches completely unreadable.

“I had no longer any authority over words,” Michaux writes at one point. “I no longer knew how to manage them. Farewell to writing!” And in fact there come moments in his narrative (if that’s the word for it) where Michaux forsakes writing altogether in favor of drawing, filling pages with abstract patterns of lines meant to convey qualities of an experience — particularly its nonlinearity and velocity — beyond language’s reach.

[ Michael Pollan’s acid trip is one of 2018’s 10 Best Books ]

Michaux’s example was very much on my mind as I sought to render my most challenging trip: smoking the toad. Within seconds of drawing the vapor into my lungs, I felt as though a Category 5 mental storm had blown through my head, obliterating every familiar point of reference: self, then time and finally matter. How do you construct a narrative in the absence of those cozy coordinates of reality? How, in other words, do you capture the experience without doing violence to it? It might not be possible: If the nature of the experience is utter mental chaos, then to choose any word or offer any metaphor — even “mental hurricane” — in an effort to convey something about it is to break faith with the truth of it, a violation of its sheer senselessness.

There is something to admire about Michaux, his perverse integrity in refusing the consolation of metaphor and ignoring the hunger of his readers for meaning. To him, metaphor, description, interpretation are all crutches — and what good are crutches when there is no floor? But where does that leave the poor reader? With an utterly impenetrable text, something more like my notes than the account I finally published.

My notes on the toad did exhibit some of Michaux’s incoherence, though even in that initial attempt at fashioning an account I found myself reaching helplessly for metaphor. Looking back, this impulse began during the experience, when I felt a sensation of “explosive flight,” as if I were strapped to the outside of a rocket shuddering through successive layers of clouds until it had passed beyond the reach of gravity.

From my notes: “I was aware that I was forming those words and the thoughts that preceded them, but for a time even that became impossible — my sense of awareness broke into fragments and flew away and there was just pure sensation — mental sensation, not physical, because I had already left my body. The chaos in my brain externalized into a chaos in the universe. The realm of space we were in was pure chaos — pre-Big Bang, the time before Genesis, void without form or order, the world before it was the world.”

In writing my account of the toad trip, I can see now that I was charting a path between Huxley’s Scylla of neat interpretation (I had none to offer) and Michaux’s Charybdis of incoherence. But even though the anarchy of my experience bore a closer resemblance to Michaux’s, it seemed to me that to give up on language and metaphor, inadequate to the experience though they might be, would constitute a breach with my reader, who had already come some distance with me in my psychedelic journeying. Could I now abandon the reader in order to preserve some ideal of literary integrity?

In the end I organized my account of the toad trip around those two metaphors: the rocket and the Big Bang. I’m not suggesting these are such great metaphors, but they were the first to come to mind as consciousness reknitted itself once the effects of the toad venom began to fade. The mind will not tolerate mental chaos for very long. Indeed, this is one of the most interesting aspects of psychedelic experience: how it allows you to observe the mind in real time as it imposes form — a metaphor, a hallucination, a pattern — on the anarchy of thought and sensation that the molecules incite.

Yet I didn’t want to leave the impression that any metaphor could “capture” the experience, so I broke the fourth wall once again to explain all this, admitting to the reader that while metaphors “inevitably deform the experience … they at least allow me to grasp hold of a shadow of it and, perhaps, share it.” And then, after likening the beginning of the trip to riding a rocket strapped to the fuselage, the G-forces pulling my face down in a taut grimace as the great cylinder crashes through successive layers of clouds with a punishing roar, I say simply:

“It was a little like that .”

Only a little. Because that’s all it was and the best I could manage — my feeble attempt to evoke a realm beyond words or sense. I doubt either Michaux or Huxley would approve of my approach of offering up imperfect metaphors accompanied by disclaimers, but at least it allowed me to construct a rough analogue of an experience that remains ineffable.

I might lack Huxley’s confidence about what my psychedelic experience means, yet I have somewhat more confidence than Michaux does in our ability to share the contents of our consciousness with others — and psychedelic experience is just an extreme case of the more general problem. This is the power of metaphors: They can take us places that simple words alone can’t, even when they’re subject to qualification by their authors. Who knows exactly what it means to say, “It was like the universe before the Big Bang”? (Who remembers the Big Bang, much less what came before it?) Such a metaphor is less a description of anything than an invitation: to imagine a time before time, a point before there was anything at all, before being itself — an invitation, in other words (in no words!), to go on a little trip of your own.

Michael Pollan is the author, most recently, of “How to Change Your Mind: What the New Science of Psychedelics Teaches Us About Consciousness, Dying, Addiction, Depression and Transcendence.”

Follow New York Times Books on Facebook and Twitter , sign up for our newsletter or our literary calendar . And listen to us on the Book Review podcast .

Explore More in Books

Want to know about the best books to read and the latest news start here..

How did fan culture take over? And why is it so scary? Justin Taylor’s novel “Reboot” examines the convergence of entertainment , online arcana and conspiracy theory.

Jamaica Kincaid and Kara Walker unearth botany’s buried history to figure out how our gardens grow.

A new photo book reorients dusty notions of a classic American pastime with a stunning visual celebration of black rodeo.

Two hundred years after his death, this Romantic poet is still worth reading . Here’s what made Lord Byron so great.

Harvard’s recent decision to remove the binding of a notorious volume in its library has thrown fresh light on a shadowy corner of the rare book world.

Bus stations. Traffic stops. Beaches. There’s no telling where you’ll find the next story based in Accra, Ghana’s capital . Peace Adzo Medie shares some of her favorites.

Each week, top authors and critics join the Book Review’s podcast to talk about the latest news in the literary world. Listen here .

Exploring History with the National Archives Special Media Division

The Unwritten Record

The Curious Case of Curious Alice

Even before the DVIC accession brought How to Succeed with Brunettes to light, I had a special place in my heart for quirky government film productions. When I first saw a beat-up, faded print of Curious Alice , it was clear that whatever anti-drug sentiment the National Institute of Mental Health (NIMH) was trying to convey, it just wasn’t working.

In Curious Alice (1971), a film intended for eight to ten year olds, our young Alice falls asleep while reading a book. She encounters cigarettes, liquor, and medicines, and realizes that they are all types of drugs. When she sees the “Drink Me” bottle, she understands that it contains something like a drug, yet after a half-second’s consideration, she drinks the entire bottle and enters a fantasy world. In Drug Wonderland, Alice learns about the hard stuff from her new friends the Mad Hatter (LSD), the March Hare (amphetamines), the Dormouse (barbiturates), and the King of Hearts (heroin). The events of Curious Alice play out as an expression of Alice’s drug trip. Unfortunately, the trip is kind of fun and effectively cancels out the film’s anti-drug message.

The psychedelic Monty Python-style animation in Wonderland is one of the best things about Curious Alice . It’s also one of the biggest reasons that the film is an overall misfire. If one listens closely, Alice is saying plenty about why drugs are bad, but the imagery is so mesmerizing that it’s hard to pay attention to the film’s message. Further, the drug users are cartoon characters with no connection to real people or real drug problems. Why take the March Hare’s drug problem seriously when you know that Wile E. Coyote falls off a cliff and is always back for the next gag?

To further confuse the message, Curious Alice somehow has too much and not enough information at the same time. Instead of focusing on situations relevant to children, the film devotes screen time to teaching kids what drugs look like and what they’re called. But really, would the average third-grader understand that the hypodermic needle the King of Hearts is carrying like a scepter isn’t filled with the same stuff as their shots at the doctor’s office? Or that the sugar cube at the Mad Hatter’s tea party is laced with LSD? The finer point of how the drugs differ from every day items is not apparent.

In the conclusion to the film, Alice suffers from nothing but a slight case of pensiveness as a result of her drug-induced adventures in Wonderland. She reaches for her book and then looks into the distance as if contemplating the cause of her bad trip. The film goes to black, so that the final message of Curious Alice seems to be that reading books can lead to scary or confusing situations. That’s assuming a kid takes away anything from the film other than “neat cartoon—when’s recess?”

This isn’t just a case of modern audiences seeing something different than when the film was originally made. In the 1972 publication, Drug Abuse Films, the National Coordinating Council on Drug Education (NCCDE) criticized Curious Alice for being confusing and potentially counterproductive to drug abuse education. In the report, the NCCDE, an independent organization that received funding from NIMH , evaluated scores of films for scientific accuracy and effectiveness. The review panel classified Curious Alice as “restricted”, writing that young viewers “may be intrigued by the fantasy world of drugs” and that it should only be presented with a “very skilled facilitator” in order to “probe for the drug attitudes” of an elementary school class. (In other words, teachers, don’t bother trying to use this film to get kids to stay away from drugs because it’ll require way too much extra work on your part.) For the record, Curious Alice was by no means singled out for criticism– the NCCDE recommended only about 16% of the films they reviewed for widespread use.

Luckily for adults, Curious Alice is a highly entertaining film. It’s still one of my favorites in the motion picture holdings at the National Archives. The animation is gorgeous, it’s beautifully executed in nearly every aspect, and the ridiculousness makes it good for a laugh or two. More importantly, Curious Alice gives us a window into the federal government’s efforts to keep kids from abusing drugs prior to the Just Say No campaign of the 1980s.

Curious Alice (Local Identifier: 511.50) is preserved at NARA in RG 511, Records of the Alcohol, Drug Abuse, and Mental Health Administration , along with dozens of other drug awareness films .

Check it out for yourself and tell us what you think in the comments.

For more on how this incredible film was saved for posterity, check out Preserving Curious Alice !

Let’s Talk About Bad Trips: Separating Difficult from Traumatic

Bad trips are a polarizing concept in psychedelics. acknowledging that they exist - and knowing how to work with them - can be healing..

Want to start a war on social media? Post something like this: “Bad trips exist.”

As somebody who has worked in the psychedelic space for years now and has supported many, many people during their trips, it’s time to come out of the closet and say it: people can be harmed by psychedelics, and bad trips exist.

But allow me to define the term “ bad trip ,” because the vague phrase has become too polarized to be meaningful.

When I talk about bad trips, I’m not talking about the harrowing, painful journeys to the underworld from which we return raw and exhausted, with some important piece of our healing work having been catalyzed.

When I talk about bad trips, I mean the trips that register in the body as a trauma or injury to the nervous system. And that is not , in fact, the same thing as a difficult trip.

What happens when we deny this truth is that we inadvertently alienate those who have had traumatic or harmful experiences. These people have endured a trauma, and are now being told that they have not.

So let’s talk about traumatic trips: The psychedelic experiences that leave us injured. Thankfully, they are rare.

I’m not just speaking from my observations as a clinician, but also from personal experience: I had a traumatic psychedelic experience on ayahuasca many years ago. I was decidedly “not okay” afterwards and required much time and support to recover.

Despite the shock and injury to my nervous system, I eventually used psychedelics again. In fact, in the eight or so years that have passed since the traumatic trip, I have openly supported the legalization of psychedelics, and have built two businesses centered around empowering people to heal with psychedelics.

I have also taken sabbaticals from my practice to work in other countries as a psychedelic facilitator. I am now a lead educator in the country’s first training program for psilocybin facilitators to be licensed by Oregon’s Higher Education Coordinating Commission (HECC). I’m a ketamine prescriber, and I train other prescribers in the use of ketamine for treating chronic pain and mood disorders. I lead and run intensive healing retreats. I’ve also taken my own fair share of mind altering substances in a variety of sets, settings, and time zones.

All of which is to say: I am no newcomer to the world of psychedelics.

And yet I cannot swallow the field’s echo-chamber-like mantra that “there is no such thing as a bad trip .” In fact, I find the rabidity with which some of my fellow cosmonauts deny the existence of bad trips to be rather disconcerting. In the more-than-one heated debate I’ve had about this topic, I’ve noticed certain patterns – or myths, if you will – around the topic of traumatic trips. I address each one here.

Myth: Bad Trips Only Happen When the Set and Setting Are Improper

If the word “only” didn’t appear in the above sentence, it would be true. In my experience in working with hundreds of patients who have used psychedelics – and in administering psychedelics myself – I’ll say that the vast majority of traumatic trips happen when the environment is not safe, calm, and supportive.

When we talk about set and setting in psychedelic harm reduction , we mean two things: (1) the person’s mindset when they took the drug, and (2) their physical environment. If somebody had just had an argument with their spouse before taking LSD, for example, that’s their set. If they were at a noisy, crowded music festival, that’s the setting. Perhaps unsurprisingly, the majority of bad trips happen when individuals on drugs feel overwhelmed in a noisy, chaotic setting like that of a concert or party. Drug-drug interactions are also often at play during difficult trips, for example, when people combine alcohol with psychedelics.

When people insist a little too strongly that, “There’s no such thing as a bad trip, if the set and setting are right,” I feel uneasy. It’s perhaps like asking a rape survivor, “Yeah, but what were you wearing?” (If you think the analogy of a bad trip and rape is too far of a reach, you luckily have never had a traumatic trip.)

There are other factors in psychedelic harm reduction that influence the outcomes. These include the substance being used, the dosage taken, and the people you’re with.

ayahuasca ceremony in yurt with a bad trip

The night of my traumatic trip was the third of a three-night ayahuasca ceremony. I was there with my then-partner. I liked the other people attending. I trusted the facilitators completely and knew they were well trained and highly esteemed by their colleagues. The medicine was pure. The environment was soothing and well contained. The music was beautiful. The first half of the third ceremony was trippy, strange, and lovely.

After I drank my second dose of the brew, however, I was decidedly NOT OKAY. I will not describe the experience here, but I will say two things about it: (1) I felt like my nervous system was being gang raped, repeatedly, and (2) I can now absolutely understand why people with psychosis sometimes choose to die by suicide.

The facilitators of the circle took care of me, pulling me out of the ceremony space and letting me try to calm down outside. Somebody stayed with me at all times until I vomited up the salt water they gave me to drink.

There’s one factor of harm reduction we don’t discuss enough: dose. It’s possible that the second cup of ayahuasca I drank that night contained more voltage than my nervous system could handle – that it was too much, too fast, and too hard for me.

The Influence of Neuroticism

Aside from the environment, another factor that can predict bad trip potential is neuroticism. Neuroticism is one of the “Big Five” traits thought to collectively form the full picture of personality.

People who score high on neuroticism tend to overthink things, typically have a hard time relaxing, and may feel irritated in noisy settings or stressful situations. These folks are often described as “high strung.”

At least two studies have shown that people who score high on neuroticism scales are more likely to have a challenging psychedelic trip than those who score lower. [1] , [2] The theory behind this is that if a neurotic’s negative thoughts or feelings arise during a psychedelic trip, the person might get pulled into an amplification spiral of their own negativity.

But does that mean it’s somebody’s fault that if they tend towards neurosis and they have a bad trip? Aren’t psychedelics supposed to help heal negativity? What does it mean that the same drugs that help soothe negative thoughts and feelings can also make us feel worse? (Let a neurotic chew on that one.)

Once again, we could very easily slip into the territory of victim blaming if we are not mindful.

While writing this article, I took the Big Five Personality Test online. I scored in a higher-than-average percentile for negative emotionality (neuroticism). That may explain why grumpy cat is one of my heroes and why my friend Greg refers to me as “a female Larry David.” It could also explain why I’m one of the unlucky few who have had a traumatic psychedelic trip. (Side note: I also scored pretty high on open mindedness, so that could explain why got into psychedelics in the first place.)

I took ayahuasca and I still hate everything

Myth: Bad Trips Are Actually Just Difficult Experiences That Haven’t Been Integrated

I continue to stay in this field because traumatic trips are, indeed, exceedingly rare, and because the healing gains people typically experience from psychedelics are unparalleled by any other intervention I’ve found.

Working regularly with patients in non-ordinary states of consciousness, I see that the most challenging experiences are often the most rewarding. Drawing from my previous experiences in volunteering with the Zendo Project and White Bird , I teach my students the tenants of “trip sitting.”

As one of the Zendo principles states: difficult is not necessarily bad. Note that the phrase is not “difficult is not bad,” but rather, “ difficult is not necessarily bad. ” In other words, difficult can sometimes be bad.

Another layer to this argument is that if you wait long enough, the bad experience will prove itself to be good. This does, indeed, happen to many people after their challenging journeys. Yet there is a difference between suggesting this to a bad trip survivor and insisting that “everyone gets the trip they need.”

Many of my new-age peers have become allergic to the word “bad,” especially within the context of bad trips. “Is anything really bad?” I’m often asked. The argument here, as I understand it, is that with every cloud there comes a silver lining, and that silver lining might just hold a very valuable teaching for us.

I admit that my own traumatic trip gave me a lesson: It taught me that there is indeed such a thing as a bad trip. Another gift was that my bad trip helped me to better understand, validate, and support others who have been harmed by psychedelics. Another lesson was this: my bad trip was an amplifier of the toxic positivity that I see running rampant in the psychedelic field.

In fact, a patient once confessed to me, “I’m just so mad at her” – her being ayahuasca – “but everyone in the group is so in love with Great Grandmother that if I say one bad thing about her, it’ll be like heresy.” I noticed that he was clenching his jaw and only breathing into the upper part of his chest. I leaned forward, looked him in the eye, and said: “Tell me exactly what you think about that bitch – you won’t offend me.”

By the end of the hour, he had raged, wept, and laughed. His breath was reaching his abdomen and his jaw was relaxed. The client messaged me some days later, saying, “That was so healing for me just to be heard, to be able to say mean things without being afraid somebody would cancel me. Thank you.”

Perhaps for this client, “the medicine” was to be heard without anybody trying to stop him from expressing anger. Maybe the bad trip was just part of the arc that took him to that finale. I don’t know.

Myth: There’s No Such Thing as Bad

There’s that old story about the Zen master, whose son got a new horse. “What good luck!” The neighbors said. “We’ll see,” said the master. One day the son was thrown from the horse and broke his leg. “How terrible!” Said the neighbors. “We’ll see,” said the master. Then the country went to war, and the army came to recruit soldiers. Because the young man’s leg was broken, they army didn’t take him to battle. “How good!” said the neighbors. “We’ll see,” said the Zen master. Perhaps there is no good or bad.

What I’ve always found lacking in this story about the Zen master was the voice of his son – the one who actually fell from the horse.

Is a bad trip like falling from a horse? It absolutely can be. Yet something about the “you just haven’t integrated it yet, there’s gold there” argument feels like a dismissive bypass. Let us consider other situations in which we could apply such a statement:

After getting food poisoning and vomiting for hours
After taking penicillin and breaking out in a full body rash
After going on a horrible date
After surviving a sexual assault
After your child has been diagnosed with a life-threatening illness
After losing a loved one to cancer
After surviving a terrible accident that has resulted in disability
After your cat has been run over by a car
After losing a house to foreclosure

Would we really tell the people in the above hypothetical situations that there was no such thing as bad shellfish? No such thing as a bad drug reaction or a bad date? No such thing as rape? No such thing as a bad diagnosis, a bad prognosis? Or how about just a bad day? Or something as non-threatening as a bad movie, a bad haircut, or a bad parking job? Would we really tell somebody whose child just died to avoid using the word “bad” to describe her condition?

Perhaps it is true that none of these things are bad, and that all of them are blessings in disguise. But would we really get righteous about it on social media, the way some of us do about denying bad trips?

And what’s so bad about saying “bad,” anyway? Must everything truly be a blessing? (The neurotic writing this article needs to know.)

I’d also like to share the story of Becks. Becks was a 24-year-old female patient of mine with anorexia nervosa who did MDMA-assisted psychotherapy to heal from PTSD (post-traumatic stress disorder) rooted in childhood sexual abuse.

In a follow-up visit, Becks told me that the MDMA-assisted therapy session (done with an underground provider) had done wonders for her. She was getting much more mileage out of her weekly therapy sessions. She was now remembering things she had repressed previously, and she was able to stay present when the memories arose.

Becks had also forgiven herself. She explained that without realizing it, she had blamed herself for what happened to her when she was a child, punishing herself through self-denigrating thoughts, food restriction, and high-risk drinking. Her MDMA-assisted therapy session helped her identify this pattern and realize that she didn’t deserve the blame or the punishment. Having forgiven herself, Becks was now sleeping better at night, eating when she was hungry, and avoiding alcohol. Clearly, much healing had occurred for her.

Yet Becks felt discouraged and worried. “I don’t think I’m doing it right,” she told me while pulling at the rings on her fingers.

“Why’s that?” I asked.

“Well,” she explained, “I know I’m supposed to get to this place where I feel like the trauma was a blessing – and that hasn’t happened.”

“You think you’re supposed to get to a place where you think that being repeatedly molested as a child is a blessing? ” I asked her.

“Yes,” she said with a defeated sigh as she looked at her shoes.

“Where’d you get that idea?”

Her head snapped up to look at me, breathless, huge-eyed. And then she burst out laughing. The laughter turned to tears. She sobbed and babbled something about a podcast she’d heard. Then she laughed some more. Her face lit up and the color returned to her cheeks.

“Becks, was being molested by your stepbrother every night a blessing?” I asked her.

“No, it was a fucking horrible nightmare that I wouldn’t wish on my worst enemy,” she declared.

“Okay,” I said, “and is it possible that it was a fucking horrible nightmare and that you still get to heal and have a happy adult life starting right now?” I asked.

“ Fuck yeah,” she said. And the look on her face told me she believed it.

(This, by the way, is what happens when you go to a doctor who scores high on neuroticism scales: We acknowledge and celebrate that life might be a fucked up mess sometimes, and that we can still heal even if we don’t buy into toxic positivity.)

(Also: I do have patients who come to see their traumas as gifts. It truly is a powerful and important step in their healing. But let’s not assume that healing cannot happen in other forms. Everyone’s path is different and valid.)

Myth: Talking About Bad Trips Is Going to Harm the Psychedelic Movement

On the day I graduated from medical school, I took an oath to First, Do No Harm . Sometimes, First, Do No Harm means doing the uncomfortable thing or saying what others don’t want to hear. In this case, it means acknowledging that there are risks to using psychedelic substances, and a traumatic trip is one of those risks.

Every therapy, every medicine, every experience comes with risks and benefits. One risk of taking vitamin C is that too much can cause diarrhea. One risk of antibiotics is that they can lead to vaginal yeast infections. One risk of using acetaminophen (paracetamol) is that it’s hard on the liver. One risk of eating a vegan diet is that it can deplete vitamin B12 stores and subsequently trigger depression. One risk of a life-saving surgery is that it can result in a lethal infection. And so forth.

Psychedelic medicines also come with their risks, and the risk of a traumatic trip should be on that list. Admittedly, it should be in small letters, towards the bottom of the list, next to the words “very rare when used in therapeutic contexts.” But traumatic trips are, in fact, “a thing.” They’re part of the fine print.

As far as I know, bad trips have not been reported in any of the clinical trials on psychedelics – but keep in mind that we haven’t had too many people go through the clinical trials as compared to the number of folks doing psychedelics “in the wild.” Bad trips may have also been down-played in the trials as “dysphoria” or “agitation” by the researchers.

Are the possible risks of psychedelic medicines worth wagering for the potential benefits? The answer to that question can only be answered on a case-by-case basis – as with any intervention.

For me personally: The healing engendered by psychedelics has far outweighed and more than redeemed the harm I’ve endured. Every time I take a psychedelic medicine now, I understand that I am taking a risk, and I make the clear, informed decision to proceed – or not to proceed, depending on the circumstance.

When I advocate for the destigmatization and legalization of psychedelics, furthermore, I don’t just act out of love for the movement: I act out of love for my patients.

What’s going to injure the psychedelic movement even more than a level-headed discussion about traumatic trips is the harm that may be caused by denying them.

How to Talk to a Bad Trip Survivor

So, what should we say to a survivor of a traumatic trip? Anything but: “There’s no such thing as a bad trip.”

If somebody tells you they’ve endured a bad trip, treat them as if they’d just told you that they survived an accident, an assault, or another kind of shock. Offer them comfort and support. Listen. Don’t ask them to prove the truth of what they say happened.

Essentially: treat them as you would treat the survivor of any kind of experience that was too much, too hard, and/or too fast for their mind, body, or spirit.

Remember that the word “trauma” does not refer to the distressing event itself, but rather to the resulting emotional and neurological response. Trauma can harm a person’s sense of Self, their sense of safety, their ability to navigate relationships, and their ability to regulate their emotions. Trauma, in other words, is injury to the nervous system that ripples outward. (To be clear: Trauma does not mean simply feeling uncomfortable or offended, as some people mistakenly use it.)

Even if integration of the experience would be helpful for the survivor – and might even help them stop using the term “bad trip” to describe it – that cannot happen at the beginning. The first thing the bad trip survivor likely needs is to know that they are safe now . The nightmare has ended, and they are loved and supported by trustworthy people who care.

How can we help others feel safe? By our presence. By regulating our own breath. By listening. By letting them know that we believe them. By showing empathy. By making them soup, gifting them a massage, or offering to pick their kids up from school. By being kind.

Even if the traumatic trip was the result of poor planning, improper set and setting, or other user error, hold your tongue for now. Think of how you might react if a friend was in a terrible car accident that resulted from driving when they were overly tired.

Think of how you might respond if a child dragged a chair to the kitchen counter and climbed atop it to try and reach the off-limits cookie jar sitting high up on a shelf – only to tumble backwards and slam onto the floor. Would you shout, “Well, that’s what you get for climbing on the chair!” while the poor kiddo cried on the linoleum? I hope not. I hope you would sit by their side, hug them, and stroke their hair. Once you felt their breathing return to normal and the smile return to their face – and not a second sooner – might you ask, “Honey, remember what we said about climbing on the furniture?”

Healing From My Bad Trip

It took me almost eight years to feel like I had fully integrated my bad trip. Curiously, what helped me complete the arc from wound to health was a peyote ceremony.

What prolonged my healing was people insisting that there was no such thing as a bad trip. I heard this line in my ayahuasca circle, at psychedelic conferences, on social media, on podcasts, and in books. The experience-denying and victim-blaming made me feel angry and alone.

Another factor that delayed my full recovery was peer pressure. Buckling to the well-intentioned insistence of friends, I returned to the ayahuasca circle (and other psychedelic circles) sooner than I truly wanted to. This meant that I was taking medicines with a mindset of doubt and fear, which resulted in several dysphoric, confusing, and terrifying journeys that only compounded the injury.

I was fortunate to find a healer who believed in bad trips and who confirmed that I was not fully in my body. Through regular sessions, I was able to return. While my therapist hadn’t had much psychedelic experience herself, she at least believed me. That allowed us to start from a place of trust and not from a place of defensiveness. I also took a break from psychedelics and instead cultivated gentler, more predictable health-affirming practices like singing and going to the gym.

Years after the experience, I read about the concept of “too much, too hard, too fast” in a book about psychedelic facilitation. I felt a surge of heat rush to my face as I read the words; hot tears filled my eyes. I hadn’t made it up. It had happened to me. I wasn’t weak, or stupid, or crazy. But why was the truth so hard for other people to accept?

I’m grateful to my own stubborn will to get better – to that spark within me that keeps me seeking out people, places, and things that can help me heal, grow, and learn.

There was, indeed, some good that came from my bad trip on ayahuasca all those years ago. The seams of that horrific shroud were sewn with golden thread. I am grateful for the blessings gleaned.

I am also grateful to my unconditionally supportive family, friends, and partner, and to Grandfather Peyote for helping me weave the blessings into my life and pull back the heavy curtain.

I had a bad trip, and that’s okay.

And you know? Considering that I’m a neurotic, I’m pretty proud of myself for saying so.

Follow your Curiosity

[1] Barrett FS, Johnson MW, Griffiths RR. Neuroticism is associated with challenging experiences with psilocybin mushrooms. Pers Individ Dif. 2017 Oct 15;117:155-160. doi: 10.1016/j.paid.2017.06.004 .

[2] Petter Grahl Johnstad (2021) The Psychedelic Personality: Personality Structure and Associations in a Sample of Psychedelics Users, Journal of Psychoactive Drugs, 53:2, 97-103, DOI: 10.1080/02791072.2020.1842569

You may also be interested in:

An illustraion of a person in distress being comforted by another person. Behind them is a whitish cloud, and behind that, a larger looming threatening cloud with a menacing face respresenting ketamine's addicitve potential. The background is lilac and has contains a diagram of the chemical composiition of ketamine, a small vial of ketamine, and an injection.

Mental Health

Self-Discovery

Self-Medicating Alone with Psychedelics.

Harm Reduction

Managing Trauma. A dark blue background with a light purple flat-color graphic of a person with dark blue hands from the dark behind them, clutching at them from all sides. On their left is a glowing orb with a butterfly and some sparkles.

Trip Killers: How To Stop an Acid Trip

Occasionally, a psychedelic trip can take a turn for the worse. This group of “trip killer” drugs are used by experienced trip sitters and medical professionals to stop the trip in its tracks.

What Are Trip Killers?

1. alprazolam (xanax), 2. lorazepam (ativan), 3. diazepam (valium), 4. clonazepam (klonopin), 5. zolpidem (ambien), 6. quetiapine (seroquel), 7. olanzapine (zyprexa) , how long do trip killers take to kick in, psychedelics that have trip killers, psychedelics that don’t have trip killers, 1. are you in over your head, 2. are you or those around you at risk, 3. do you need to sober up asap, who shouldn’t use benzodiazepine-based trip killers, 1. the “bad trip”, 2. you or your trip sitter realize it’s time for a trip killer, 3. you enter “the placebo effect”, 4. the trip killer begins to take effect, 5. the trip comes to an end , 6. you feel almost sober, 1. sourcing the trip killers responsibly, 2. get the dose right, set (mindset), final word: using trip killers .

In most cases, “a bad trip” is just your mind’s way of showing you factors in your past or present life that need to be confronted and dealt with. However, in some cases, a bad trip can become nightmarish to the point that it may put yourself or others in danger.

In these situations, it may be beneficial to have some form of a trip killer on hand to get you out of the negative headspace and effectively “kill” the trip.

Let’s delve into what trip killers are, when to use them, explore the risks, and discuss what to expect when you use one halfway through a psychedelic journey.

Trip killers are substances that help mellow out or block the effects of psychedelic substances. They “bring you back to reality” when a trip takes a dark turn.

Trip killers are taken with the intent to end a psychedelic trip. There is no one substance that will help end a psychedelic experience, and not all trip killers are effective for all psychedelics — you have to use the right trip killer depending on what substance you’re using.

The most common trip killers are benzodiazepines, but other drugs, such as certain antipsychotic medications, can also be effective.

Just as it’s important to know the right dose of the psychedelic you’re using, it’s important to take the right dose of trip killers too. Some of these substances are exceptionally potent and should be taken with great care.

Trip killers are a last resort and should only be used when the effects of a bad trip start to become dangerous to oneself or others.

Ideally, people who are at risk of such an experience will be under the supervision of a trained psychedelic facilitator who can help walk the user through the challenging visions they may be receiving. In many cases, the bad trips are where most of the benefits of psychedelics derive from — so stopping them in their tracks should be avoided if possible.

Top 7 Trip Killers

By far, the most effective and commonly used trip killers are benzodiazepine drugs . We’ll look at these substances first because they offer the strongest and fastest-acting way to end a psychedelic experience.

Benzodiazepines aren’t for everyone; some people should avoid them entirely. In these cases, there are other options available (keep reading).

It’s important to note that benzodiazepines can be dangerous, especially if mixed with other sedative drugs or alcohol. They’re also notoriously addictive. Taking benzos habitually doesn’t end well for anybody.

For now, let’s take a look at the most common trip killers:

Alprazolam is one of the fastest-acting trip killers in the benzodiazepine family — but it’s also one of the shortest-lasting. The effects of Xanax, although fast-acting, only last for around four to six hours.

Xanax is a favored trip killer among psychonauts purely because of its fast-acting nature. It’s designed for people to use at the first sign of an anxiety attack to stop it in its tracks.

The effects of alprazolam start to kick in within 15 minutes or so and reach peak effects in as little as 45 minutes.

Xanax does have a habit of wiping your memory, in a sense. When consumed with other substances or at too high a dose, it can make you black out and lose all memory of the previous night.

When you consume Xanax as a trip killer, you should be prepared to lie down and get some rest. When you awake, you may have an extremely blurry memory and struggle to recall anything about the experience. This can be a positive or negative point, depending on what you want to achieve from the psychedelic trip.

Lorazepam is considered an intermediate-acting benzodiazepine. This means it won’t kick in quite as fast as something like Xanax — but the effects last for over eight hours. This is a better option for long-lasting psychedelics, such as DOX compounds, 2CX compounds , or other amphetamine psychedelics .

Lorazepam is great for getting you out of a bad trip, but it may cause drowsiness to the point you fall asleep. This can be a plus since it allows you to rest easy after a bad experience, but it does put a complete halt on your psychedelic experience.

Diazepam isn’t as fast-acting as lorazepam and alprazolam, but it is one of the longest-lasting of the popular benzodiazepine trip killers. The effects of diazepam can last for over 12 hours.

It’s reported that this trip killer takes “too long” to take effect when swallowed in pill form. However, the onset of effects can be sped up significantly by chewing the drug, so it can be sublingually absorbed under the tongue.

Diazepam works great to get you out of a nightmarish thought loop, but it doesn’t have the same effect as lorazepam and alprazolam in the aspect of drowsiness. Many people report that taking diazepam during a bad trip helps them calm down without completely removing the psychedelic effects of the drug.

Clonazepam is considered the slowest-acting of the benzodiazepine trip killers. It can take between one and four hours after taking it to reach peak levels in the blood. Of course, this can be sped up by chewing the pill and allowing it to absorb sublingually.

Although clonazepam takes a long time to kick in, the effects can last up to 12 hours, and the half-life is also long, standing at around 40 hours — meaning it won’t be cleared from the body for a couple of days.

This is the least popular of the common benzodiazepine trip killers, but it’s often one of the easiest to get hold of (depending on where you live). Some like Klonopin for its euphoric nature, which many other benzodiazepines don’t have.

Zolpidem is classified as a Z-drug — which is a group of compounds that exert benzodiazepine-like effects but have an entirely different structure.

These drugs work in much the same way as benzos and are also considered useful as trip killers. But there’s one catch — these drugs tend to be much more sedative than their benzodiazepine cousins. People who take Ambien to stop a trip will almost always fall asleep shortly after. You may or may not remember the experience the following morning.

While Z-drugs carry a lower risk than most benzodiazepines, there’s still a great deal of risk associated with their use. Getting the dose right, avoiding mixing with other depressants, and only using if you’ve been approved by a doctor are still key elements for using these substances safely.

Although nowhere near as popular as benzos, another common option is antipsychotics like quetiapine (Seroquel).

Antipsychotic medications treat psychosis. People with schizophrenia, bipolar disorder, severe depression, and Alzheimer’s are often prescribed these.

Quetiapine is classified as an atypical antipsychotic. It differs from typical antipsychotics because it produces fewer extrapyramidal symptoms and has a lower risk of tardive dyskinesia. In simpler terms, it produces fewer side effects than typical antipsychotics, such as the inability to sit still, muscle contractions, tremors, and stiff muscles.

Antipsychotics are the best trip killers for people that can’t use benzodiazepines or Z-drugs.

Seroquel typically takes 20 to 60 minutes to kick in when consumed sublingually at a dose of around 25–50 mg.

Olanzapine is another atypical antipsychotic reported to be effective in dulling the effects of psychedelics. This compound has a particularly high affinity for the 5HT2A receptor and is, therefore, better for killing the trips from tryptamine-based psychedelics like LSD, psilocybin, or DMT.

Zyprexa is less effective for dopaminergic or NMDA-based psychedelics such as the psychedelic amphetamines (MDMA, MDA, cathinones) or arylcyclohexylamines (PCP, ketamine, and others).

Olanzapine usually takes around 30 minutes to kick in at a 10–20 mg dose.

How Do Trip Killers Work?

Benzodiazepines such as diazepam or lorazepam (or other sedative anxiolytics) are usually the substances a doctor will administer if you’re submitted to the hospital due to signs of psychosis from consuming too much of a psychedelic substance.

These drugs work similarly to those for someone with a panic or anxiety attack. They have anxiolytic, sedative, and relaxant properties that all work to reduce anxiety levels and negative thought loops.

More specifically, benzodiazepines kill the trip by amplifying the activity of GABA in the brain. GABA is a neuroinhibitor — which means it reduces brain activity.

When we’re anxious, the inhibitory effects of GABA result in a dramatic reduction in anxiety levels. We think less, care less about our problems and feel more calm and relaxed. In higher doses, this causes full-on sedation.

The same concepts apply to psychedelic experiences. Paranoia, anxiety, and fear responses experienced during the psychedelic state can all be muted by dulling brain activity with GABA-boosting drugs.

Antipsychotic trip killers work a little bit differently. These drugs work as serotonin and dopamine antagonists (blockers). The exact mechanism is still not fully understood, but the leading theory is that certain antipsychotics reverse the effects of psychedelics by blocking the 5-HT2A receptors.

5-HT2A is one of the main receptor sites on which psychedelics such as LSD and psilocybin work. Some, but not all, psychedelic substances bind to these receptors to induce their psychedelic effects.

Every trip killer is different — some kick in quickly (10–20 minutes); others take an hour or more.

Here are some of the average onset times for the four most popular benzo-based trip killers listed above.

These refer to the oral onset time of these drugs. It’s not a good idea to smoke, inject, or snort benzodiazepines for any reason.

Alprazolam (Xanax): 10–20 minutes
Lorazepam (Ativan): 20–45 minutes
Diazepam (Valium): 1–2 hours
Clonazepam (Klonopin): 45–60 minutes

When Do Trip Killers NOT Work?

Trip killers don’t work on every psychedelic substance. Benzodiazepines and antipsychotic medications are effective for standard, serotonin-based psychedelics such as LSD and psilocybin. However, there are a few substances that don’t have any effective trip killers.

Always educate yourself on any substance before using it. You should know how much to take, what to expect during the trip, and onset times and duration. You should also know whether there’s an effective trip killer for it.

Psychedelic trips from some of the most commonly used psychedelics can be stopped by the use of benzodiazepines or antipsychotic medications.

These are the most prevalently used and have the most research surrounding them, though trip killers likely work on more substances than the ones listed below.

Here’s a list of commonly used psychedelic substances that do have effective trip killers:

LSD (lysergic acid diethylamide) (and other lysergamide psychedelics )
Psilocybin (the active compound in magic mushrooms )
4-AcO-DMT (synthetic shrooms)
5-MeO-DMT (the active compound in bufo toad venom )
N,N-DMT (the active ingredient in ayahuasca )
2C-B (and other 2C psychedelics )
NBOMes (N-bombs)
Synthetic Cathinones (Bath Salts)
MDMA (and other MDXX psychedelics )
Mescaline (the active compound in Peyote & San Pedro cactus)

Some psychedelic substances do not have trip killers. Not all psychedelics affect the brain in the same way; therefore, trip killers, such as benzodiazepines, will not end all psychedelic experiences.

For example, many dissociative drugs like PCP or ketamine work via the NMDA receptors in the brain. The psychedelic trips these drugs produce appear to be unaffected by benzodiazepines. Making matters worse, most dissociatives are also considered sedatives — which are notoriously dangerous to mix with benzodiazepines.

Other substances, such as salvinorin A from salvia or any of the deliriant hallucinogenics, don’t diminish after taking benzodiazepines or Z-drugs. There are no effective trip killers for these substances.

If you plan on consuming any of the substances listed below, be warned that you have no option but to ride the experience out naturally. Never consume a substance that you’re not comfortable with.

It’s a good idea to have a trip sitter around that you trust who can help you through a difficult experience should it arise.

Here are some of the more common psychedelic substances that do not have effective trip killers:

Datura (a hallucinogenic flower from the nightshade family)
Brugmansia (commonly known as angel’s trumpet)
Phencyclidine (and other arylcyclohexylamines )
Ketamine (and other dissociatives )
Grayanotoxins (found in Rhododendron flowers)
Xenon gas or nitrous oxide gas
Salvia divinorum

When Should You Use a Trip Killer?

Preferably, you should never consume a trip killer. A “bad trip” can often unlock a door that will show you traits in our personality (our “ shadow ”) or traumas and aspects in life that we need to heal in order to live a better life.

A typical “bad trip” is often a lesson containing vital information we can use to work on ourselves and get over mental blocks that reduce our quality of life. Using a trip killer to end an experience like this may be counterintuitive. Doing so could close “the door” that leads to healing.

Many experienced psychonauts swear off ever needing to consume trip killers to end a trip because they believe every vision has value. However, trip killers definitely have their place. You should always be safe rather than sorry and never bite off more than you can chew in terms of set, setting, and dosage. End the trip if you feel you’re in over your head.

As long as you use psychedelics responsibly , you’ll likely never need a trip killer. Proper dosing is the best way to ensure this, but having your frame of mind and setting fit for a psychedelic trip is also important. This way, if a bad trip occurs, you have the strength to deal with it.

Sometimes, we don’t get it right. A “bad trip” can spiral out of control into a nightmarish event that can be truly traumatic. When this happens, you and the others around you could be at risk.

People who swear off trip killers may have experienced a challenging trip but may not have had a truly terrifying one. It may never happen, but it could occur at any time, so it’s always wise to have some form of trip killer available.

A nightmarish loop of events during a trip can seem to last forever, and in some, it can lead them to cause harm to themselves or others. This is rare but not unheard of. Trip killers can be a lifesaver for those who find themselves trapped in such a situation.

In our opinion, trip killers should be a part of every psychonaut’s tool kit. You should strive never to use them, but they should be readily available in case a trip takes a dark turn that you feel you can’t benefit from or work through without putting yourself or others at risk.

No matter how responsible you are when planning a psychedelic trip, there are times when circumstances come up that are outside your control. You think you have the day to sit and trip, but suddenly something comes up (family emergency, etc.), and you need to be sober ASAP.

Even though a trip killer won’t make you feel “normal,” it’ll speed up the process and make you more clear-headed than you would be without it.

Some people should avoid benzodiazepine-based trip killers at all costs . This section outlines who should not take these types of trip killers and what they can use instead.

Although most psychedelics aren’t addictive, benzos definitely are. Anyone with an addictive personality or who has had a past dependence on benzos or similar substances should avoid using these as trip killers.

Benzos have some of the longest-lasting, worst, and most savage withdrawals of any substance on the planet.

Withdrawal symptoms can last for months. If you become addicted and prolong the use of these substances, quitting cold turkey isn’t an option. Simply quitting after prolonged benzo abuse can be life-threatening due to the body seizing up.

In simple terms: don’t use benzo-based trip killers if there’s a chance you’ll get addicted to them.

What To Expect When You “Kill” a Trip

As I’ve mentioned, trip killers aren’t an instant solution. You’re not going to magically become sober as soon as the pill touches your tongue. The onset time and experience will vary depending on the type of trip killer consumed, the dosage taken, the psychedelic consumed, and how far into your trip you are.

That being said, I can give you a rough idea of what happens when consuming a benzodiazepine trip killer during a bad experience.

Let’s paint a hypothetical picture.

A few hours after consuming your chosen psychedelic, you enter an area of dark and disturbing thoughts somewhere in your subconscious mind. At first, tell yourself, “It’s okay; it’s just the psychedelic messing with my brain.”

After a while, you start to convince yourself that this is, in fact, real, and you begin to sink into nightmarish thought loops.

If the situation starts to get out of hand, a trip killer might be employed to bring you back to some semblance of reality.

You chew one milligram of Xanax in the hope that the sublingual absorption will allow it to take effect quickly.

Although unpleasant, the acrid taste of the trip killer in your mouth relieves you. You associate the taste with the trip coming to an end. When you swallow your saliva, you feel a wave of calm rush over you because you know that this nightmare will all be over soon.

About 15 to 30 minutes later (depending on the trip killer consumed), you notice a wave of relaxation come over you. Any feelings of anxiety and panic start to wash away as the drug begins to take effect.

Not only do the dark thought loops start to diminish, but you also start to feel as though you don’t care about much of anything at all. You become emotionless and calm. You may or may not continue to experience hallucinations, but none of them seem to steal your attention.

If you’re not laying down already, you’ll probably seek out somewhere to post up and relax for a while as your muscles start to feel weak.

One hour after taking the trip killer, your hallucinations have likely died down substantially, and you feel much more rational and level-headed. You may even regret taking the trip killer — if you were in this head space originally, perhaps you wouldn’t have had such a terrifying experience.

Two to three hours after ingesting the trip killer, you feel more or less sober (depending on the psychedelic you consumed). Most of the effects of the psychedelics have worn off, and if you’re not already asleep, you’re probably feeling pretty drained and ready for some zzz’s.

You’ll be emotionally and physically exhausted by this time, and you’ll likely reach for a bottle of water and a hefty snack to restore the energy lost throughout the ordeal.

Safety Aspects to Consider When Using Trip Killers

There are a few things to consider when purchasing and adding trip killers to your psychedelic tool kit. The most effective trip killers — benzodiazepines — are restricted in terms of sale and use. This can make it difficult to legally purchase these drugs, which is where our first safety aspect stems.

If you cannot obtain trip killers (benzos) in a legal way — via prescription from a doctor — the level of risk goes up substantially.

The most popular benzodiazepines for recreational use are Valium (diazepam) and Xanax (alprazolam). These can be obtained on the black market, but it’s not recommended.

Illegal vendors distributing Valium and Xanax don’t necessarily consider the consumer’s best interest. Several samples of these substances have contained drugs such as fentanyl (an extremely dangerous synthetic opioid).

Clandestine drug manufacturers use tablet molds that produce exact replicas of the prescribed Xanax and Valium tablets. Criminals produce pills with these molds that look the same but contain a cocktail of potentially life-threatening substances. Whether you’re tripping or not, taking one of these pills at any time may pose a serious health risk.

Basically, unless you’re getting your drugs from a pharmacy, you can never be sure the drugs you’re using are safe.

If you absolutely have to purchase “trip killers” from the black market, you must test them using — at the minimum — a fentanyl test kit. We cannot stress this enough.

You can also buy benzo test kits to help identify what adulterants may be contained in your pills.

You should check your benzos before you need them. You’re not going to have time to test them for safety if using them as a trip killer.

Another safety aspect to consider is, of course, dosage. Getting the correct dosages for each substance is critical to avoid overdosing . However, you also need to consume enough of the substance to kill a trip.

Several individual drugs fall under the benzodiazepine classification; although similar, the required dosage for each differs.

It’s important to note that your weight, gender, and familiarity with the drug will affect the exact dose. A heavier person that regularly consumes benzos will need a far larger dose than a small-framed person that has never tried the substance before.

Below I’ve listed the recommended dosages of the four most popular trip killers based on first-hand reports and prescribed dosage guides. However, you should take these numbers with a grain of salt and do your own research outside before consuming anything to kill a trip. These substances can be dangerous.

Alprazolam (Xanax): 0.5 to 1 mg
Lorazepam (Ativan): 0.5 to 1.5 mg
Diazepam (Valium): 5 to 10 mg
Clonazepam (Klonopin): 1 to 1.5 mg

As you can see, the recommended dosages for killing a trip vary and depends on where you are on your trip.

Again, I can’t stress this enough — everyone’s required dosage will be different because of a variety of factors. Unfortunately, your required dose will be something you’ll have to find out through experience. Just be aware that trip killers of this nature don’t work immediately, so don’t keep dosing if you don’t experience any trip-calming effects right away . This is how overdoses occur.

How To Minimize the Risk of a Bad Trip

Trip killers should only be used in an emergency when a trip takes a dark turn that could harm you or others around you. It’s best to avoid trip killers at all costs, and these steps can also help you have the best trip possible.

Preparation is key. If you’ve experimented with psychedelics before, you must have heard of set and setting.

The set is the frame of mind you’re in. When consuming psychedelic substances, you should never be in a negative, anxious, or unstable state of mind. Entering a trip with negative thoughts in your head is a surefire way to a nightmarish trip.

It’s important to relax your body and mind before entering a trip. This can be done by simply putting yourself in a good headspace by recalling a positive memory or experience. Practicing meditation and/or yoga can also help you relax into a positive state of mind.

The setting is the space you’ll experience the trip in. The setting is extremely important in psychedelics and will help you stay in the right “set.” Playing relaxing music, putting beautiful pictures around you, and lighting a few candles can make the setting more relaxed and inviting.

Many people also like to trip out in nature. This is a fantastic way to do it; however, several variables can affect your trip.

If you head out into nature for a psychedelic trip, ensure it’s in a safe area with no foot traffic. Make sure the weather is good, and there are no external factors that may “freak you out.” The last thing you want is bad weather (a storm, for example) or a stranger entering your space — this will likely lead to a bad experience.

Another way to ensure a smooth trip is to have an object nearby that means something to you. This object helps connect you to the physical world and can get you back on course if your trip dives into a dark place . Simply holding the object and looking at it may just be enough to snap you back to reality.

This technique is definitely something to try before resorting to the use of trip killers.

Trip killers may be an important part of the psychonaut’s tool kit. Hopefully, you will never need to use them, and you should strive to work through difficult experiences rather than chemically halt them.

However, if you have a truly terrifying psychedelic experience, they will help you get back to reality as quickly and safely as possible.

The most popular and effective trip killers are benzodiazepines or Z-drugs, but some antipsychotic medications are also effective and a good alternative for people with addictive personalities.

When sourcing trip killers, it’s important to test their purity. Several drugs on the black market are contaminated with fentanyl — an extremely dangerous synthetic opioid that’s similar to morphine but much stronger. This drug can be life-threatening, so it’s of paramount importance that any drug sourced on the black market is tested thoroughly.

Regardless of whether you have trip killers available, you should always practice safe psychedelic use. Ensuring that your set and setting are perfect before a trip helps mitigate the risk of a bad trip occurring. As we said, you should never need to use a trip killer, but they should be available as an absolute last resort.

How to Make DMT: 3 Separate Methods (N,N,DMT & 5-MeO-DMT)

Can Psychedelics Help With Problem Solving?

The Mind’s Theatre: Psychedelics & Dreams

What is the psilocybin cup (cup winners & strongest strains 2021 & 2022).

How to Make Ayahuasca: Step-by-Step Guide

Where Does Ketamine Come from?

Subscribe for more psychedelics 🍄🌵.

This will close in 20 seconds

Entertainment

GIPHY Clips

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

View all journals
My Account Login
Explore content
About the journal
Publish with us
Sign up for alerts
Open access
Published: 27 March 2017

Enhancing titres of therapeutic viral vectors using the transgene repression in vector production (TRiP) system

H. E. Maunder 1 ,
J. Wright 1 ,
B. R. Kolli 1 ,
C. R. Vieira 1 ,
T. T. Mkandawire 1 nAff2 ,
S. Tatoris 1 nAff3 ,
V. Kennedy 1 ,
S. Iqball 1 ,
G. Devarajan 1 ,
S. Ellis 1 ,
N. G. Clarkson 1 ,
K. A. Mitrophanous 1 &
D. C. Farley 1

Nature Communications volume 8 , Article number: 14834 ( 2017 ) Cite this article

7175 Accesses

16 Citations

16 Altmetric

Metrics details

Expression systems
Gene therapy
Genetic vectors

A key challenge in the field of therapeutic viral vector/vaccine manufacturing is maximizing production. For most vector platforms, the ‘benchmark’ vector titres are achieved with inert reporter genes. However, expression of therapeutic transgenes can often adversely affect vector titres due to biological effects on cell metabolism and/or on the vector virion itself. Here, we exemplify the novel ‘Transgene Repression In vector Production’ (TRiP) system for the production of both RNA- and DNA-based viral vectors. The TRiP system utilizes a translational block of one or more transgenes by employing the bacterial tryptophan RNA-binding attenuation protein (TRAP), which binds its target RNA sequence close to the transgene initiation codon. We report enhancement of titres of lentiviral vectors expressing Cyclo-oxygenase-2 by 600-fold, and adenoviral vectors expressing the pro-apoptotic gene Bax by >150,000-fold. The TRiP system is transgene-independent and will be a particularly useful platform in the clinical development of viral vectors expressing problematic transgenes.

Synthetic virology approaches to improve the safety and efficacy of oncolytic virus therapies

Stable expression of large transgenes via the knock-in of an integrase-deficient lentivirus

Self-attenuating adenovirus enables production of recombinant adeno-associated virus for high manufacturing yield without contamination

Introduction.

The use of engineered viruses to deliver transgenes for therapeutic effect is wide-ranging. Contemporary gene therapy vectors based on RNA viruses such as γ-Retroviruses and Lentiviruses 1 , 2 , and DNA viruses such as Adenovirus 3 and Adeno-associated virus (AAV) 4 have shown promise in a growing number of human disease indications. These include ex vivo modification of patient cells for hematological conditions 5 , 6 , and in vivo treatment of ophthalmic 7 , cardiovascular 8 , neurodegenerative diseases 9 and tumour therapy 10 . Immunogen-encoding vectors based on Poxviruses 11 and Avian viruses 12 are widely used in human and animal vaccinations.

A major goal for the field of viral vector manufacturing is the improvement of production cell output during upstream processing. One of the limiting factors of attaining high-starting (crude) vector titres can be the constitutive and often high-expression of the transgene protein within production cells. For many viral vector systems, the ‘benchmark’ crude titres are those achieved with vectors encoding ‘inert’ reporter genes, such as green fluorescent protein (GFP). However, the biological activity of a therapeutic protein may impact on the production cells’ metabolism/viability and/or the assembly/activity of vector virions, leading to reduced crude titres that may be several orders of magnitude lower than the benchmark. Transgene protein(s) can also be incorporated or associated with the vector, which may affect downstream purification and potentially be presented to the immune system upon vector administration. This latter point may have more bearing in pre-clinical studies during delivery of human genes to immune-competent animals, although exposure of human subjects to therapeutic proteins containing artificial linkers/domains also may not be ideal.

Typically, powerful promoters are used to drive the transgene transcription unit; these may be cellular promoters such as the human phosphoglycerate kinase promoter (huPGK) or heterologous viral promoters such as from Cytomegalovirus (CMV), or be inherent to the virus platform 13 . While the use of tissue-specific promoters (that are less active in production cells) can be employed to address this problem 14 , they are often not available, or are not used due to low or unpredictable activity, when translating from animal to human studies during vector development.

We have developed the TRiP system for the universal production of DNA- and RNA-based viral vectors that encode transgenes whose activity is detrimental to vector titres. The TRiP system exploits the Bacillus subtilis protein Tryptophan RNA-binding Attenuation Protein (TRAP) and a TRAP-binding sequence (tbs) inserted upstream of the transgene open-reading-frame (ORF), which acts to repress translation. The natural function of TRAP is to control the tryptophan synthase pathway in bacteria 15 . This is achieved through both transcriptional- and translational-attenuation mechanisms upon stimulation of TRAP binding to the tbs in the excess of L -tryptophan (see Fig. 1 for an overview). Most TRAP homologues form a stable 11-mer ring, around which the tbs is bound. The tbs has a general consensus of [KAGN 2–3 ] 9–11 in vivo, although the number of ‘N’ spacer nucleotides can be intermittently greater than this 16 . The mechanism of translational-modulation involves the binding of TRAP to the tbs, which causes rearrangement in the RNA secondary structure in the adjacent sequence of the leader, resulting in occlusion of the Shine–Dalgarno sequence and inhibition of translation initiation. A substantial body of research exists on the characterization of natural TRAP function, with a particular focus on use of in vitro techniques 16 , 17 , 18 , 19 . This has revealed an extremely high-affinity of TRAP for an optimal tbs [KAGNN] 11 in the nanomolar range. Consequently, this led others to apply this stable TRAP/tbs complex as a positive control in development of a screening tool for novel RNA-binding proteins in mammalian cells 20 .

(i) TRAP is an 8 kDa protein that associates into a homomeric, torroidal ring comprising 11 TRAP monomers. The trp operon RNA leader contains a TRAP binding sequence (tbs) of KAG repeats separated by two/three, or infrequently more than three spacing nucleotides that contribute to secondary structure within the leader; this results in exposure of the Shine–Dalgarno (SD) sequence and consequently efficient translation of the trp operon mRNA. When L -tryptophan is present in excess, each of the 11 TRAP monomers binds L -tryptophan resulting in a conformational change on the outside of the 11-mer ring such that it can bind tightly to the tbs. This re-orders the secondary structure within the leader, causing the SD to become unavailable leading to attenuation of translation initiation. (ii) The TRAP-tbs configuration used by Nie and Htun to exemplify a RNA-binding protein-identification screen 20 , and in this study for blocking of transgene translation in viral vector production cells.

Here, we fully develop a mammalian cell expression system for TRAP-mediated repression of ‘problematic’ transgene expression in viral vector production cells. We further demonstrate that the TRAP/tbs complex can be used to repress cap-independent translation, allowing multicistronic ORFs to be simultaneously repressed in a single cassette. Depending on the transgene, this allows substantial improvements in vector output titres, in some cases close to or at the benchmark, as demonstrated by proof-of-principle examples for the ‘TRiPLenti’, ‘TRiPAdeno’ and ‘TRiPAAV’ systems. Finally, deeper comparative analysis of protein profiles of lentiviral vector preparations made under standard versus TRiP approaches by mass spectrometry spectral index-normalized quantitation (MS-SINQ) suggests that downstream processing and/or quality of vector drug product may also benefit from repression of transgene(s).

TRAP blocks single- or multi-cistronic mRNA translation

To create the mammalian cell-based TRiP system, we codon-optimized the sequence of TRAP from Bacillus subtilis for human codon bias and generated a simple gene-expression cassette ( Fig. 2a ). To report potential transgene repression by TRAP, a tbs comprising the consensus [KAGNN] 11 was cloned within the 5′UTR of a GFP-reporter construct ( Fig. 2a ). Co-transfection of HEK293T cells with either TRAP plasmid or stuffer DNA control, together with pCMV-GFP or pCMV-tbsGFP was performed, and cells analysed by flow cytometry two days later ( Fig. 2b,c ). In addition, total cytoplasmic RNA was extracted in parallel and qRT-PCR performed to quantify GFP sequences ( Fig. 2c ). Similar numbers of GFP-positive cells and fluorescence intensities were achieved in transfections without TRAP; however, these were greatly reduced specifically for only pCMV-tbsGFP in the presence of TRAP ( Fig. 2b ). To quantify the effect of TRAP on GFP expression within transfected cultures, we generated a GFP ‘Expression Score’ (median fluorescence intensity [MFI] × percentage GFP-positive cells) in a similar manner to other reports 21 , which was consistent with GFP immunoblot data ( Supplementary Fig. 1 ). The Expression Score for the pCMV-tbsGFP plus TRAP combination was 100-fold lower than for the other conditions ( Fig. 2c ). In contrast, GFP messenger RNA (mRNA) levels were similar across all conditions ( Fig. 2c ), which confirmed that the TRAP-tbs complex was mediating a translational block, rather than affecting transgene mRNA levels. TRAP-tbs mediated repression was also achieved with other commonly used promoters including huPGK ( Fig. 2d ).

( a ) The GFP reporter plasmid containing the tbs within the 5′UTR of the transcription unit and the TRAP-expression plasmid used throughout the study. B. subtilis TRAP was codon-optimised for human cell expression and C-terminally Hisx6 tagged. ( b ) 2-D plots (FSC v FL1/GFP) of HEK293T cells co-transfected with GFP reporter plasmids and TRAP or control plasmids, analysed by flow cytometry (MFI, median fluoresence intensity [arbitrary units]). ( c ) GFP Expression scores for the co-transfections were generated (percent GFP × MFI; plotted on left y-axis) and qRT-PCR data of cytoplasmic GFP RNA copies detected plotted on the right y-axis; grey bars—RT-positive, white bars—no RT (residual pDNA control). All data are mean average values±s.d. [log 10 -transformed data] ( n =8); * P <1.7 × 10 −17 [Welch’s t -test]. ( d ) Fold repression of GFP Expression Scores (difference in ±TRAP) of other promoters tested in the ‘promoter-tbs-GFP’ configuration in co-transfected HEK293T cells±pEF1a-coTRAP[H6] (note that total fold repression is related to promoter strength due to a greater differential between ‘on’ levels compared to untransfected cells). Data are mean average values±s.d. [log 10 -transformed data] ( n =3); * P <0.001 [Welch’s t -test]. (CMVp, cytomegalovirus promoter; EF1a, Elongation factor 1 alpha promoter; INT, synthetic intron; tbs, TRAP-binding sequence; coTRAP[Hisx6], codon-optimized tryptophan RNA-binding attenuation protein with C-terminal Histine tag; polyA, polyadenylation signal; SFFV, spleen focus-forming virus promoter; CMV+betaglb intron; CMV promoter with human beta globin intron; RSV, Rous Sarcoma Virus promoter; HSV-TK, Herpes simplex virus thymidine kinase promoter; SV40, Simian virus 40 promoter; huPGK, human phosphoglycerate kinase 1 promoter). are representative of two independent experiments.

We investigated whether the TRAP-tbs paradigm could be applied to translation repression of multiple open-reading-frames (ORFs) encoded within transgene cassettes. We constructed bicistronic plasmids wherein the transgene transcription unit was driven by the CMV promoter and encoded luciferase at the first position (ORF1) and GFP downstream of an internal ribosomal entry site (IRES) element (ORF2). These constructs differed in that they were fully, individually or not controlled by TRAP-tbs at the ORF1 and ORF2 positions ( Fig. 3a ), enabling both cap-dependent and cap–independent mechanisms of translation initiation to be tested. In HEK293T cells, co-transfection experiments demonstrated that expression of multiple ORFs can be simultaneously repressed by TRAP, only when the tbs is placed upstream of the translation initiation site; this occurred for both cap-dependent and cap–independent mechanisms of expression ( Fig. 3b ). Both luciferase and GFP expression were repressed by TRAP-tbs by over two orders of magnitude. The capability of the TRiP system to repress IRES-driven transgene expression will be of particular benefit to retrovirus-based vector production systems because IRES-dependent transgene expression from full length human immunodeficiency virus 1 (HIV-1)-based vector genome RNA (vRNA) was found to constitute 20–30% of total transgene protein ( Supplementary Fig. 2a,b ). This is conceptualized in Fig. 4a , which describes the components of the TRiPRetro/TRiPLenti systems.

( a ) Bicistronic reporter plasmids encoding Firefly luciferase (Luc; ORF1 position) and green fluorescent protein (GFP; ORF2 position); ORF2 being dependent on cap-independent translation. The constructs vary in position and number of tbs sequences controlling the ORFs. ( b ) HEK293T cells were transfected with the bicistronic plasmids±TRAP, and a Renilla Luciferase plasmid was co-transfected in all conditions to allow normalization of FireFly luciferase activity. Duplicate sets of cells were either analysed for normalized luciferase activity in cell lysates (left y-axis; yellow bars) or live cells analysed for GFP expression by flow cytometry (right axis; green bars). All data are mean average values±s.d. [log 10 -transformed data] ( n =3); * P <1.5 × 10 −7 , ** P <1.4 × 10 −5 [Welch’s t -test]. (CMVp, Cytomegalovirus promoter; tbs, TRAP-binding sequence; IRES, internal ribosomal entry site (encephalomyocarditis virus); polyA, polyadenylation signal). Results are representative of two independent experiments.

( a ) The TRiPRetro/TRiPLenti system requires: a tbs-modified vector genome, gag/pol, envelope and TRAP expression cassettes. HIV-1-based vector systems additionally require RRE/rev for export of genomic vector RNA (vRNA), whereas Equine Infectious Anemia Virus [EIAV] vRNA can be made rev-independent by use of an upstream open-reading frame (ORF) (unpublished). The TRAP-tbs configuration is capable of repressing cap-dependent and –independent transgene expression from full length vector genome RNA and the ‘internal’ transcript. ( b ) GFP Expression Scores in production cells (green bars) and crude vector titres on HEK293T cells (grey bars) of GFP-expressing HIV-1-based vectors. Data are mean average values±s.d. [log 10 -transformed data] ( n =3); * P <3.2 × 10 −6 , ns P <0.17 [Welch’s t -test]. ( c ) DNA-integrating titres of HIV-CMV-tbsCAR5T4 and HIV-CMV-tbsGFP vectors produced±TRAP in HEK293T cells. Data are mean average values±s.d. [log 10 -transformed data] ( n =4); * P <4.2 × 10 −4 [Welch’s t -test]. ( d ) DNA-integrating titres of EIAV-based vectors produced±TRAP in HEK293T cells; EIAV-CMV-COX2 and EIAV-CMV-tbsCOX2 vectors were made without or with TRAP respectively, representing standard versus ‘transient’ TRiPLenti protocols. EIAV-CMV-tbsCOX2 vector was additionally made in cells stably expressing TRAP, representing the ‘stable’ TRiPLenti protocol. Data are mean average values±s.d. [log 10 -transformed data] ( n =3); * P <1.3 × 10 −5 , ** P <3.2 × 10 −4 [Welch’s t -test]. ( e ) HEK293T cell lysates from EIAV-CMV-[±tbs]COX2 vector production, as well as end-of-integration assay cell lysates, were analysed by immunoblotting to COX-2 (molecular weight marker in kilodaltons). (Pro, promoter; Ext Pro, external promoter; Int Pro, internal promoter; polyA, polyadenylation signal; Ψ, packaging signal; RRE, rev-responsive element; cppt, central polypurine tract; tbs, TRAP-binding sequence; IRES, internal ribosomal entry site (encephalomyocarditis virus); PRE, post-transcriptional regulatory element; ppu, polypurine tract; SIN, self-inactivating; An, poly-adenines). Results are representative of two independent experiments.

Enhanced lentiviral vector titres using the TRiPLenti system

Common methods of viral vector manufacture include the transfection of mammalian cell lines with vector DNA components, followed by a limited incubation period and then harvest of crude vector from culture media and/or cells 22 . To evaluate the impact of transgene expression on vector production, a simple therapeutic/reporter genome mixing experiment can reveal the extent of the likely impact of therapeutic protein expression on vector production ( Supplementary Fig. 3 ). Our experience with lentiviral vector development indicates that a high-proportion of therapeutic proteins impact on crude vector titres to a measurable level, but that the contribution of transgene protein activity to loss in vector titre may be full or only partial, that is, other factors such as genome size/sequence may also contribute.

During the early stages of development of the TRiPLenti system, we sought to determine any potential adverse impact of the TRAP-tbs interaction on vector activity (for example, blocking of reverse transcription) since the full length vRNA also contains the tbs. We produced HIV-CMV-GFP and HIV-CMV-tbsGFP vectors using either the TRiPLenti system or the standard approach, and generated GFP Expression Scores in production cells, as well as vector titres ( Fig. 4b ). Approximately 100-fold repression of GFP expression was observed in production cells expressing pHIV-CMV-tbsGFP plus TRAP, but surprisingly the vector titres generated were not significantly different under both approaches. Since GFP is well known not to impact on vector production, this indicated that the TRAP-tbs configuration did not adversely affect vector biomechanics per se . It also demonstrated that transgene expression in target cells was not affected by TRAP/tbs, as the biological measure of titre (vector titre, Fig. 4b ) was similar to the integrating units as determined by qPCR ( Fig. 4c ).

To demonstrate the broad utility and potency of the TRiPLenti system, we produced HIV-1 and equine infectious anemia virus (EIAV)-based lentiviral vectors expressing therapeutic transgenes, some of which were found to be extremely detrimental to production titres. First, we generated the vector HIV-CMV-tbsCAR5T4 (an early stage vector encoding a chimeric antigen receptor directed to the 5T4 tumour antigen 23 ) in HEK293T cells with or without TRAP, and titrated them by vector-DNA integration assay. Under the standard production method, HIV-CMV-tbsCAR5T4 titre was 300-fold lower than the HIV-CMV-GFP benchmark. However, in the presence of TRAP the titre was rescued by 30-fold ( Fig. 4c ).

We then used a vector under development for the treatment of glaucoma, which expresses Cyclo-oxygenase-2 (COX-2) to reduce intra-ocular pressure 24 . EIAV-CMV-COX2 and EIAV-CMV-tbsCOX2 vectors were produced with or without TRAP in HEK293T cells or in HEK293T cells stably expressing TRAP, and COX-2 levels in replicate cultures were analysed at early and late time points during production (HEK293T cells only). Equal volumes of crude vector were titrated by DNA integration assay ( Fig. 4d ) and end-of-assay cell lysates analysed for COX-2 protein content ( Fig. 4e ). The titre of EIAV-CMV-COX2 vector made under the standard production method was three orders of magnitude lower than the EIAV-CMV-GFP benchmark vector. In contrast, EIAV-CMV-tbsCOX2 vector titres were rescued by 100-fold and 600-fold in the ‘transient’ and ‘stable’ versions of the TRiP system, respectively. COX-2 protein levels were highly repressed throughout production, but in target cells were proportional to the vector titres ( Fig. 4e ).

We also performed a vector mixing experiment with a second problematic therapeutic EIAV vector expressing Factor-VIII (known to inhibit VSV-G envelope incorporation into EIAV virions 14 ), which confirmed that the stable version of the TRiP system allowed further improved recoveries of vector titres ( Supplementary Fig. 4a–c ). These data indicate that in the stable TRiP system, the pre-existing pool of TRAP within the production cell maximizes the opportunity for transgene mRNA to be repressed, leading to further benefits in titre recovery. Further examples of TRiPLenti vectors are displayed in Supplementary Fig. 4d .

Improved protein profiles of TRiPLenti vectors encoding COX2

Expression of the COX-2 protein during EIAV vector production drastically impaired vector titre. To assess the impact on viral particle protein content, we generated concentrated, serum-free preparations of EIAV-CMV-GFP, EIAV-CMV-COX2 and EIAV-CMV-tbsCOX2, all produced in the presence of TRAP. Analysis by MS-SINQ allowed the relative quantification of viral and cellular proteins within preparations, and hits that varied by >4-fold between replicates were excluded from subsequent data analysis. Supplementary Fig. 5a displays average data for the top 154 proteins in EIAV-CMV-GFP vector preparations, representing ∼ 90% of protein abundance. Gag and Pol were detected close to the expected 20:1 ratio, as well as cellular proteins documented to be incorporated into HIV-1 virions 25 , 26 . The key differences between the three vector preparations showing both common and uncommon proteins are portrayed graphically in Fig. 5 , indicating that EIAV-CMV-GFP and EIAV-CMV-tbsCOX2 had similar profiles in contrast to EIAV-CMV-COX2, which had a large number of low abundant proteins making up its profile ‘tail’. We performed a three-way comparison of common proteins (plus COX-2) detected in all three vector types, normalizing abundance to that of the EIAV-CMV-tbsCOX2 vector. This allowed comparison of the effects of expression of COX-2 or GFP, modelling ‘active’ or ‘inert’ proteins, respectively, and are summarized in Table 1 , which presents select data from both the first (duplicate) and second (quadruplicate) independent experiments. COX-2 content in EIAV-CMV-COX2 was more abundant than Gag protein, and was almost 3,000-fold greater in abundance than COX-2 levels in EIAV-CMV-tbsCOX2 in the first experiment and COX2 was not detectable in EIAV-CMV-tbsCOX2 vectors in the second experiment. A number of observations were made that suggest that the 2–3 log difference in transducing activity between the two COX-2 vectors ( Fig. 4d ) is multifactorial. COX2 expression mediated both a minor quantitative effect on virion abundance (Gag; ∼ 5-fold) and a major qualitative effect on virion activity, namely reduced VSV-G incorporation ( ∼ 50-fold). These data were consistent with the other physical analysis of vector preparations performed, namely F-PERT (measures vector virion RT activity) and immunoblot analysis for capsid and VSV-G ( Supplementary Fig. 5b ). It is reasonable to suggest that these two effects of COX2 can be multiplied (5 × 50=250-fold), which therefore largely explains the multiple log reduction in titres. We cannot exclude the possibility that down-/up-regulation of cellular factor(s) within EIAV-CMV-COX2 vector preparations may have contributed further to reduced virion activity (indeed, this is why we performed the MS-SINQ analysis to potentially identify such a factor). For instance, it is possible that the (85-fold) reduction in fibronectin within the EIAV-CMV-COX2 preparation could have been a contributing factor, which has been reported to play a role in HIV-1 infection and can enhance retroviral vector transduction 27 , 28 , although we have not formally pursued this hypothesis. However, these data show that the in-/direct effects of transgene protein during vector production are complex, and therefore the most pragmatic solution is to suppress transgene expression.

Quadruplicate serum-free vector concentrates were analysed by Mass Spectrometry Spectral Index-Normalized Quantitation (MS-SINQ). The profiles represent hits that varied by less than four-fold between replicate samples. EIAV-CMV-GFP and EIAV-CMV-COX2 represent ‘inert’ and ‘active’ transgene profiles respectively, compared to the ‘repressed’ transgene profile of EIAV-CMV-tbsCOX2. A large number of rare proteins were upregulated in EIAV-CMV-COX2 preparations (making up its profile ‘tail’), and to a lesser extent also in EIAV-GFP. Changes within the top ∼ 150 proteins ( ∼ 90% of total detected) in EIAV-CMV-COX2 were less pronounced, with the exception of Gag, VSV-G and Fibronectin, which were reduced and appeared at lowing rankings. Common hits were used in three-way comparison of peptide pools of quadruplicates of each vector type, summarized in Table 1 .

Surprisingly, TRAP was typically detected as the most abundant protein within vector virions regardless of the presence of a tbs in the vector genome, presumably due to its overexpression and passive incorporation during budding. Despite this, we were not able to detect an antibody response to TRAP (or COX-2) in rats injected intracamerally with purified EIAV-CMV-tbsCOX2, in contrast to VSV-G, to which 1/3 animals responded ( Supplementary Fig. 6 ).

Recovery of DNA-based vectors expressing an apoptotic gene

To examine the utility of the TRiP system for other viral vector platforms we applied this approach to develop the TRiPAdeno ( Fig. 6a ) and TRiPAAV ( Supplementary Fig. 8a ) systems. We first designed an Adenovirus type 5 shuttle plasmid containing the CMV-tbsGFP cassette ( Fig. 6b ), and assessed the repression of GFP during co-transfection of HEK293T cells with Ad5 packaging backbone using the RAPAd in-mammalian cell recombination system. Approximately 100-fold repression of GFP transgene expression was observed during first generation vector isolation ( Fig. 6c ), as well as 2–3 orders of magnitude of transgene repression during a single round of amplification in cells stably expressing TRAP (HEK293T.TRiP) ( Fig. 6d ). These initial results encouraged us to demonstrate proof-of-principle of the utility of the TRiPAdeno system, by attempting to produce adenoviral vectors expressing the pro-apoptotic protein Bcl-2-associated X protein (Bax). The shuttle plasmid pAdShuttle-CMV-tbsBax-iGFP was constructed so that GFP could be used as a marker for vector titration ( Fig. 6b ). While performing the recombination step in HEK293T and HEK293T.TRiP cells to make Adeno-CMV-tbsGFP or Adeno-CMV-tbsBax-iGFP vectors, we observed that only the HEK293T.TRiP cells supported expression of GFP from pAdShuttle-CMV-tbsBax-iGFP, indicating that expression of Bax within HEK293T cells produced a strong inhibitory effect on global gene expression, presumably as a consequence of induction of apoptosis ( Supplementary Fig. 7a ). It should be noted therefore that cells transduced with the Adeno-CMV-tbsGFP and Adeno-CMV-tbsBax-iGFP vectors have opposite GFP phenotypes depending on whether TRAP is co-expressed. We were only able to observe cytopathic effect (CPE) within the HEK293T.TRiP cells (for either vector type) during the 14 day recombination phase, perhaps reflecting some intrinsic characteristic of the TRiP cell line over its parent. Crucially, we observed that the plaques that formed within cultures producing Adeno-CMV-tbsBax-iGFP had a higher degree of GFP expression compared to the cells surrounding them ( Supplementary Fig. 7b ), indicating that amplification of GFP-expressing vector had occurred.

( a ) The TRiPAdeno system, which requires: vector genome (with tbs-modified transgene(s)), helper functions and a TRAP expression cassette. TRiPAdeno is suited to the production of first/second generation Ad vectors, as well as Gutted (Helper-dependent) and Helper-independent Oncolytic Ad vectors. ( b ) The tbs-modified adenoviral type 5 shuttle plasmids used in the study, containing the ‘left’ ITR, transgene cassette and adenovirus homology block of 9.2–16.1 map units. Bax was used to exemplify production of a vector expressing high-levels of a toxic gene (see text and Fig. 7 ). ( c ) Repression of GFP expression during vector recombination together with the pRAPAd back-bone plasmid in HEK293T cells. Data are mean average values±s.d. [log 10 -transformed data] ( n =3); * P <6.7 × 10 −5 [Welch’s t -test]. ( d ) Vector stocks generated from ( c ) were used to transduce either HEK293T or HEK293T.TRiP cells at a multiplicity of infection (MOI) of 0.01, and replicate cultures analysed by flow cytometry at different points post-inoculation during one round of vector amplifcation phase to generate GFP Expression Scores. (Pro, promoter; ITR, inverted terminal repeat; Ψ, packaging signal; tbs, TRAP-binding sequence; ORF, open-reading frame; `i', internal ribosomal entry site (encephalomyocarditis virus); polyA, polyadenylation signal; An, poly-adenides).

We therefore used the vector stocks of both vector types generated in HEK293T.TRiP cells to model vector amplification from material that might otherwise be generated in bacteria or in vitro , where the toxic effect of Bax would not have been present. We took each of the triplicate vector stocks and initiated four rounds of vector amplification on either HEK293T or HEK293T.TRiP cells. In the first round we observed massive levels of cell-rounding and detachment of HEK293T cells post-transduction with Adeno-CMV-tbsBax-iGFP, and these cells appeared to have negligible levels of GFP fluorescence ( Fig. 7a ). In contrast, HEK293T.TRiP cells were GFP-positive and gave an appearance consistent with Adenovirus-related CPE. Each subsequent amplification round was initiated with <1% of vector material from the preceding round.

( a ) Representative phase or fluorescent microscopy images of HEK293T or HEK293T.TRiP cell cultures in the first amplification phase post-inoculation with Adeno-CMV-tbsGFP or Adeno-CMV-tbsBax-iGFP vectors produced in HEK293T.TRiP cells (black scale bar=100 μm). ( b ) Vector stocks from the final round of amplification/passaging were titrated on HeLa cells and HeLa-TRAP cells. Data are mean average values±s.d. [log 10 -transformed data] ( n =3); * P <5.4 × 10 −4 , ** P <1.5 × 10 −4 [Welch’s t -test]. ( c ) Vector stocks from the final round of amplification/passaging were titrated by qPCR of purified vDNA using a GFP primer/probe set. Data are mean average values±s.d. [log 10 -transformed data] ( n =3); * P <3.1 × 10 −2 , ** P <6.7 × 10 −8 [Welch’s t -test]. ( d ) Vector stocks from the final round of amplification/passaging were used to transduce HeLa and HeLa-TRAP cells at an MOI ∼ 5, and transduced cell lysates analysed for functional expression of transgene cassettes by immunoblotting to Cleaved-PARP (induced by Bax over-expression), Bax, GFP and GAPDH (molecular weight marker in kilodaltons). Triplicate Adenoviral vector stocks were derived and amplified/passaged from three independent recombination steps; qPCR and immuoblotting were each repeated twice.

Crude vector stocks from amplification phase IV were titrated on both HeLa and HeLa-TRAP cells to allow GFP TU per ml titre values to be generated for Adeno-CMV-tbsGFP and Adeno-CMV-tbsBax-iGFP vectors, respectively ( Fig. 7b ). Strikingly, HEK293T.TRiP cells supported amplification of Adeno-CMV-tbsBax-iGFP vector to titres in excess of 1 × 10 8 GFP TU per ml, which exceeded the Adeno-CMV-tbsGFP titres produced from these cells. HeLa-TRAP cells transduced with material derived from amplification of Adeno-CMV-tbsBax-iGFP vector on HEK293T cells did not produce any quantifiable titre. The apparent titre of HEK293T.TRiP-produced Adeno-CMV-tbsBax-iGFP vector on HeLa cells (1 × 10 6 GFP TU per ml) is believed to reflect the initial burst of expression of both transgenes before the effects of global protein expression inhibition by Bax; this effect appeared to be less potent in HeLa cells compared to HEK293T cells, suggesting that the latter may be more sensitive to Bax over-expression.

We performed qPCR on purified vDNA using a GFP primer/probe set ( Fig. 7c ), which showed that Adeno-CMV-tbsBax-iGFP vectors produced in HEK293T.TRiP cells had crude particle titres of 3 × 10 10 genomes per ml, which represented a >150,000-fold excess over signal detected in material derived from HEK293T cells. Since we were able to detect GFP sequences in material derived from HEK293T cells above cell background, this may have represented the early stages of amplification of a recombinant form of Adeno-CMV-tbsBax-iGFP that presumably had lost both GFP expression (since we observed none) and/or functional Bax expression, although we did not observe any appreciable CPE in these cultures in any round of amplification beyond round 1.

To assess the stability and functionality of the transgene cassettes within the amplified vector stocks, we transduced both HeLa and HeLa-TRAP cells with vectors at a multiplicity of infection (MOI) of ∼ 5, based on the biological GFP titres of these stocks. Since we were not able to detect any biological titre in Adeno-CMV-tbsBax-iGFP vector material derived from HEK293T cells, we transduced cells with as much material as practicable, which resulted in a ∼ 15-fold volume excess over Adeno-CMV-tbsBax-iGFP vector material derived from HEK293T.TRiP cells. We analysed post-transduced cell lysates for levels of GFP, Bax and cleaved Poly (ADP-ribose) polymerase (clv-PARP; a marker of apoptosis) by SDS-PAGE and immunoblotting ( Fig. 7d ). This key experiment demonstrated that: [1] the ‘tbs controlled’ ORFs of GFP and Bax in Adeno-CMV-tbsGFP and Adeno-CMV-tbsBax-iGFP respectively, had maintained their ability to be repressed by TRAP ( Fig. 7d : see GFP panels, lanes 1–4 [OFF] versus 9–12 [ON] and Bax panels, lanes 7–8 [OFF] versus lane 15–16 [ON]; [2] high-level Bax expression (above endogenous) was only detected in HeLa cells transduced with Adeno-CMV-tbsBax-iGFP vector made using the TRiP system ( Fig. 7d : see Bax panels, lanes 13–14 [HEK293T] versus 15–16 [HEK293T.TRiP]); and [3] only the high-level of Bax expression led to induction of cleaved PARP ( F ig. 7d : see clv-PARP and Bax panel; lanes 15–16), demonstrating that the Bax protein that was expressed was also functional.

Finally we evaluated the TRiPAAV system ( Supplementary Fig. 8a ) versus the standard approach in producing self-complementary (sc)AAV2-GFP vectors by co-transfecting HEK293T cells with packaging/helper plasmids with either pscAAV2-CMV-GFP or pscAAV2-CMV-tbsGFP with or without TRAP plasmid. GFP Expression scores were generated from replicate production cell cultures after flow cytometry, and purified vectors were titrated on HEPG2 cells ( Supplementary Fig. 8b ). These data show that 100-fold repression of the transgene occurred during AAV vector production and the TRAP-tbs configuration does not intrinsically affect vector activity, as the biological titres of TRiPAAV-produced vectors were equivalent to those made by the standard method. We were then able to recover titres of scAAV2-CMV-tbsBax vectors to the same level as GFP-expressing vectors in HEK293T cells, only when TRAP plasmid was supplied in during vector production ( Supplementary Fig. 8c ).

It is widely known that viral vector-encoded transgene expression can adversely affect vector titres. This effect may be anticipated from the outset of vector development, particularly when utilizing known cytotoxic transgenes, for example, in cancer-killing vectors 10 , 29 or anti-HIV-1 genes that encode restriction factors that affect retroviral vectors, for example, APOBEC3G (ref. 30 ) and TRIMcyp (ref. 31 ). It is conceivable that viral vector genomes expressing gene-editing transgenes may also be cytotoxic depending on the degree/type of off/on-target effects, particularly in the context of stable producer cell lines (PrCLs). The effects of other transgene proteins may be less predictable or more subtle, for example by affecting vector packaging or exclusion of glycoproteins from the virion envelope. Alternatively, cellular proteins may be incorporated into or excluded from virions, which may play a key role in virion activity 25 , 26 , 32 . To address this issue we have devised the TRiP system to minimize vector transgene expression in production cells and thus reduce any such effects.

We initially identified COX2 expression to be highly detrimental to EIAV vector titres. However, upon the application of TRiP system to the production of these vectors we observed up to a 600-fold recovery in titres, demonstrating the potency of this method of transgene repression. Although the underlying mechanism through which COX2 expression reduces titres is unclear we did observe that it correlated with a ∼ 50-fold reduction of VSV-G incorporation into vector virions. We have previously shown that the degree of VSV-G incorporation into lentiviral vector virions modulates their activity 33 . Similarly, expression of Factor-VIII has been shown to have a similar effect on EIAV-based lentiviral vectors 14 . However, we cannot rule out a contribution of cellular factor(s) (up or down-regulated) in the reduction of titres of EIAV-CMV-COX2 vector preparations. COX-2 is a multifunctional protein, and its expression is variably altered by different viruses during infection 34 . In this study, the number of cellular proteins in the top 250 proteins up- or down-regulated by more than 10-fold within EIAV-CMV-COX2 vector preparations were 24 and 14, respectively. While some of these were glycoproteins involved in basement membrane or extracellular matrix formation (and it is tempting to link this to the reported role of cell migration by COX2 in immortalized cells 35 ), we cannot exclude the possibility that mere over-expression of COX2 (itself being a glycoprotein) simply impeded the secretory pathway or induced endoplasmic reticulum stress, with some glycoproteins being more sensitive than others. This perhaps reflects the inherent as well as unpredictable biological activities of therapeutic transgene proteins in mammalian cells, and justifies the need to prevent them during vector production.

The potential impact of transgene expression in production cells on vector titres and strategies to address the issue has been the focus of previous studies. In contrast to the translational block imposed by the TRiP system described here, others have attempted to suppress vector transgene expression by utilizing transcriptional control 29 , 36 , 37 or through use of a ligand-induced riboswitch 38 . Employment of transcriptional repressor systems may be limited in the magnitude of repression due to upstream read-through from the 5′LTR during generation of full length packageable RNA (for example, retroviral vectors), or by ITR-driven genome replication (for example, AAV/Adeno vectors). It also may be difficult to engineer the repressor binding site within the desired transgene promoter without affecting transcriptional start site usage, while also maintaining repression levels. The presence of highly structured riboswitches within transgene UTRs may result in attenuated transgene expression in target cells, such as via Protein Kinase R activation 39 . Furthermore the use of riboswitches in lentiviral or retroviral vectors would lead to cleavage of the vector genomic RNA, with a likely adverse effect on vector titres.

One attractive approach is the strategy of utilizing the RT step during retroviral vector transduction to activate/up-regulate the transgene cassette only in target cells—first termed ‘ReCon’ vectors 40 , 41 , 42 , 43 . While these approaches have variable success in the degree of transgene repression during vector production, it is clear that the generation of the vector genome molecule can be impacted. This approach is typically troubled by reduced titres of upwards of 2- to 10-fold compared to the benchmark GFP standard, even before leaky expression of a toxic transgene is taken into account. This is likely due to unwanted side effects of the types of modifications employed. Those studies indicate that insertion of (inverted) heterologous transcription elements within LTR regions can lead to promoter competition or perhaps interfere with aspects of reverse transcription. It is conceivable that inversion of the transgenic cassette may result in new splice sites or other unstable elements, leading to a reduction in the amount of vRNA available for packaging.

The mechanistic advantage of the TRiP system is that translational repression does not intrinsically impede the DNA- or RNA-based viral vector systems tested empirically here, and can repress cap-dependent and -independent protein translation levels of multiple transgenes by over two orders of magnitude. This is mediated via a relatively short 55 nucleotide sequence, which does not significantly impact on vector capacity, and works independently of the promoter employed. Surprisingly, reverse transcription of lentiviral vectors was unaffected by the presence of a tbs within the genome, suggesting that the TRAP detected within virions was either not bound to vRNA or that reverse transcriptase can pass through the TRAP-tbs complex. The degeneracy of the tbs consensus allows for flexibility in the final sequence utilized; obviously ATG codons and cryptic splice sites should be avoided. The TRAP protein is not toxic to production cells, and so if the protein is able to interact with cellular RNAs, these are either relatively weak associations or stronger interactions do not result in any cytotoxic phenotype. We therefore expect the TRiP system to be broadly applicable to most, if not all viral vector platforms.

The lack of antibody response to TRAP in rats treated intracamerally with EIAV-CMV-tbsCOX2 in the eye (an organ/route known to be particularly sensitive to inflammation) provides evidence that the presence of TRAP protein within retroviral vector virions is unlikely to be problematic. In support of this, it is our experience in the clinic that human antibody responses to protein in purified VSV-G pseudotyped lentiviral vector preparations were only found at the highest doses, and were primarily to the viral glycoprotein, which is present on the virion surface 44 . Nevertheless, future investigation into potential pre-existing anti-TRAP responses in human sera may be warranted for application of the TRiPRetro/Lenti platform.

Production titres of therapeutic vectors can be increased by several orders of magnitude using the TRiP system, and in some cases at the platform benchmark. The ability of the TRiPAdeno and TRiPAAV systems to produce both Bax-expressing and GFP-expressing vectors to equivalent titres is particularly impressive, and to our knowledge the first time this has been achieved using a powerful, constitutive promoter. This may genuinely offer the gene therapy/vaccine field the opportunity to exploit a new category of viral vectors expressing high-levels of potently toxic transgenes, and broadens the potential repertoire of therapeutic proteins that can be evaluated and delivered by viral vectors.

We are exploring other potential benefits; it is conceivable that the incorporation/association of the transgene protein in/on virions may affect downstream processing such as virion capture or filtration, particularly if the transgene protein is incorporated into the virion surface. While some transgene proteins may be considered inert (such as GFP) —with low/no impact on crude titres—the effect on the protein profile of vector preparations and presumably of the cells from which they are derived is not likely to be zero. This has implications for PrCL development, where transgene protein may alter their growth characteristics compared to the packaging cells from which they are derived, perhaps making the development path less predictable. In addition, there is potential to present a varying identity/quantity of cellular, as well as transgene protein, to the immune system during direct in vivo gene therapy.

Finally, a major advantage of the TRiP system is the standardization of manufacture within a bio-similar vector platform since only the vector components and TRAP will be expressed in production cells. As more gene therapies succeed in the clinic, it is likely that regulators will place greater emphasis on robust generation of purer vector product and more stringent product specifications. The TRiP system will therefore have broad appeal in the viral vector community and its simple application has the capability of transforming gene therapy approaches that may currently be derailed by poor vector production, and perhaps opens the door to the production of a new variety of viral vectors expressing potently toxic proteins, such as armed-oncolytic vectors. The TRiP system will be a useful platform in the clinical development of viral vectors expressing problematic transgenes and is a major step towards the generation of vector production systems that are ‘independent’ of the transgene cassette.

The TRAP expression plasmid pEF1α-coTRAP[H6] encodes Homo sapiens -codon optimized Bacillus subtilis TRAP [GenBank: ABN13202.1] fused with a C-terminal 6 × histidine tag. The stable TRAP expression cassette used to make HEK293T.TRiP cells additionally encoded the EMCV IRES and either the blasticidin (HEK293T.TRiP[3D]) or puromycin (HEK293T.TRiP[H1]) resistance genes. The GFP reporter plasmids encode enhanced GFP from Clontech (Takara) and the wild type EIAV LTR (nt1-323 of SPEIAV-19), which contains a polyadenylation signal. The 5′UTRs were either 85 nt from CMV promoter (control) or a UTR-tbs sequence ( tbs ; modified from ref. 20 ), ORF start):

5′GGTCAGATCCGCTAGCGCTACCGGACTCAGATCTC GAGTTTAGCGGGTGGAGAAGAGCGGAGCCGAGCCTAGCAGAGACGAGAAGAGCT ACAGCCACCATG. For other promoter-driven tbsGFP reporters, the tbs-kozak sequence above was inserted directly between the existing UTR of the respective promoter and the ATG codon.

EIAV-based vector genomes were derivatives of pONY8.9NCZ (ref. 14 ), wherein the lacZ gene was replaced with either eGFP (EIAV-[±tbs]GFP), codon-optimized COX-2 [NCBI ref seq: NP_000954.1] (EIAV-[±tbs]COX2) or Factor VIII (ref. 14 ) (EIAV-[±tbs]Factor VIII). The EIAV GagPol and VSV-G expression plasmids have been described previously 33 , 45 . Our HIV-1-based vector platform has been described previously 4 , 46 , 47 . The CAR5T4 codon-optimized transgene encodes a chimeric antigen receptor targeting the 5T4 cancer antigen 48 . The 5′UTRs within transgene cassettes were those stated for the GFP reporter plasmids unless otherwise stated.

The scAAV vector genomes contained a trs deletion and SV40 polyadenylation signal, and were fully re-derived by GeneArt/Life Technologies. The 5′UTRs within transgene cassettes were those stated for the GFP reporter plasmids unless otherwise stated.

The first generation Adenoviral shuttle vector plasmid pAdShuttle-CMV-GFP was pacAd5-CMV-GFP(Control) from the RAPAd system (CellBiolabs), and the 5′UTR-tbs sequence cloned into this plasmid to generate pAdShuttle-CMV-tbsGFP. The pRapAd-backbone plasmid was pacAd5 9.2–100 from the same system.

The Bax open reading frame (GeneBank: AAH14175.1) was codon-optimized ( Homo sapiens ) by GeneArt/Life Technologies, and cloned into the AAV or Adeno vector genome/shuttle plasmids.

Both the HEK293T.TRiP[3D] (used for all indicated EIAV vector studies) and the HEK293T.TRiP[H1] (used for Adenoviral and AAV vector studies) cell lines were derived from a GMP bank of HEK293T cells; all have subsequently been verified by PCR single-locus technology (Eurofins Medigenomix Forensik GmbH) and verified against the DSMZ database. HeLa cells (ECACC, 93021013) were transduced with MLV-coTRAP[H6]-iresPuro and selected with puromycin to generate a pool resulting in ‘HeLa-TRAP’ cells; these were used for biological titration so that no further replication of Ad vectors could occur (HeLa cells being E1 deficient), unlike HEK293T/HEK293T.TRiP cells. HEK293T-based cell lines were tested negative for mycoplasma.

Lentiviral vector production

The standard scale production of lentiviral vectors was in 10 cm dishes under the following conditions (all conditions were scaled by area when performed in other formats): HEK293T cells were seeded at 3.5 × 10 6 cell per plate in 10 ml complete HEK293T media (DMEM (Sigma) containing 10% heat-inactivated FBS (Gibco), 2 mM L-glutamine (Sigma), 1 × NEAA (Sigma)) and incubated at 37 °C in 5% CO 2 through-out production. Approximately 24 h later, cells were transfected using the following mass ratios of plasmids for EIAV vector production: 4 μg genome, 2 μg gag/pol, 0.1 μg VSV-G, and 0.56 μg TRAP or pBlueScript. This represented a genome:TRAP plasmid molar ratio of 5:1. Transfection was mediated by mixing DNA with Lipofectamine 2000CD in Opti-MEM according to manufacturer’s protocol (Life Technologies). Sodium butyrate (Sigma) was added ∼ 18 h later to 10 mM final concentration for 5–6 h, before 10 ml fresh complete media replaced the transfection media. For serum-free vector production for SINQ analysis, vector was harvested in Freestyle-293 media containing 0.1% Cholesterol lipid (Life Technologies). A single harvest was performed 20–24 h later, vector supernatant filtered (0.22 μm) and frozen at −20/−80 °C. For HIV-1 vector production, the following mass ratios of plasmids were used per plate: 4.5 μg genome, 1.5 μg gag/pol, 1.1 μg rev, 0.7 μg VSV-G and 1 μg TRAP or pBlueScript. This represented a genome:TRAP plasmid molar ratio of 5:2. The remainder of the process followed that stated for EIAV vectors. Note that for GFP and luciferase/GFP reporter plasmid evaluations, the GFP:TRAP plasmid molar ratio was 5:2, and pBluescript was used to ensure total DNA transfected was the same in all conditions.

Adenoviral vector production

Production of first generation GFP expressing vectors occurred by recombination of pAdShuttle-CMV-[±]tbsGFP plasmids with the pRapAd backbone in HEK293T cells. HEK293T cells were seeded at 5.8 × 10 5 cells per 6-well in 3 ml complete media, and incubated at 37 °C in 5% CO 2 through-out production. Approximately 20 h later, cells were transfected using the following mass ratios of plasmids for Adeno vector production: 166 ng pRapAd-backbone, 666 ng shuttle, and 666 ng TRAP or pBlueScript. This represented a shuttle:TRAP plasmid molar ratio of 5:2. Transfection was mediated by mixing DNA with FuGENE 6 (2.9 μl per μg DNA) and Opti-MEM (112 μl per μg DNA) according to manufacturer’s protocol (Roche). Approximately 20 h later, 3 ml fresh complete media replaced the transfection media and cultured until ∼ 50% cpe was observed and cells harvested. Cells were freeze-thawed three times before clarification and filtration (0.22 μm) of crude vector stocks. Amplification of vectors from crude stocks was carried out by infection of HEK293T or HEK293T.TRiP cells at MOI 0.01 and cultures incubated for 48 h. Replicate cultures were sacrificed for GFP analysis at stated times during amplification.

Amplification of Adeno-CMV-tbsGFP and Adeno-CMV-tbsBax-iGFP vector stocks occurred by inoculation of 6-well cultures of HEK293T or HEK293T.TRiP cells pre-seeded with 9 × 10 5 cells per well, with 40% of material generated from the freeze-thaw phase of HEK293T.TRiP cell cultures that displayed cpe. For amplification phases 2–4, fresh cell cultures at 10 cm 2 plate scale (pre-seeded 20 h prior with 4.5 × 10 6 cells per plate) were inoculated with ∼ 0.7% of freeze-thawed/clarified material from the preceding round in 10 ml media; this generated ∼ 1 ml of crude vector in serum-free media at each round.

Assays for measuring transgene expression

Expression of GFP was carried out by flow cytometry (FACSVerse, BD Biosciences), out-gating dead cells beforeanalysis of FL1 channel events. GFP Expression scores were calculated by multiplying percent GFP-positive cells by the median fluorescence intensity of events within the GFP-positive gate. GFP, COX-2, Bax, Cleaved-PARP and GAPDH expression in cell lysates was carried out by SDS–Polyacrylamide gel electrophoresis (SDS–PAGE) under reducing conditions, Western transfer and immunoblotting using antibodies to GFP (ab290, Abcam), COX-2 (CAY160112, Cayman Chemical), Bax (ab32503, Abcam), Cleaved-PARP (ab140360, Abcam) and GAPDH (ab9485, Abcam) Species-specific HRP conjugated secondary antibodies were used at 1:1,000 dilution. Expression of luciferase was carried out using the Dual luciferase reporter assay (Promega). Full images of cropped blots are presented in Supplementary Figs 9 and 10 .

Detection of cytoplasmic GFP RNA copy-number by qRT-PCR

Total cytoplasmic RNA was extracted and purified from cells using an RNeasy mini kit (QIAGEN). One microgram of RNA was treated with DNAse I (Ambion) for 1 h before inactivation. 50 ng of DNAase I-treated RNA was used in qRT-PCR reactions comprised of Taqman One step RT-PCR master mix (Life Technologies) under standard chemistry RT-PCR cycling conditions using a QuantStudio 6 (Life Technologies). A primer-FAM-probe set was designed to specifically detect a region of the GFP ORF. Negative control reactions contained no RT to control for DNA contamination.

Viral vector titration assays

DNA integration assay for titration of lentiviral vectors has been described elsewhere 44 . Titration of GFP-encoding viral vectors occurred by serial dilution and 5–6 h transduction of target cells (in FBS- and 8 μg ml −1 polybrene-containing media for lentiviral vectors, and in serum-free media for Adenoviral-based vectors) before addition of fresh media, followed by incubation for 2 days. Target cell counts were made before transduction. Cultures were analysed for percent GFP expression using a FACSVerse and vector titres calculated accordingly. For qPCR of Adeno vectors, vDNA was extracted and purified from 90 μl of crude vector material using the Qiagen DNA minikit using carrier RNA, generating 60 μl of pure DNA. Neat or 10-fold diluted DNA served as template for TaqMan qPCR reactions using Taqman Universal PCR master mix (Life Technologies). Reactions were performed under standard chemistry PCR cycling conditions using a QuantStudio 6 (Life Technologies). A primer-FAM-probe set was designed to specifically detect a region of the GFP ORF:

Fwd - 5′·CAACAGCCACAACGTCTATATCATG·3′,

Probe - 5′·[FAM]CCGACAAGCAGAAGAACGGCATCAA[TAMRA]·3′,

Rev - 5′·ATGTTGTGGCGGATCTTGAAG·3′

Protein analysis of EIAV-based vectors by SINQ

Quantification was carried out by Cytome Technologies (Upper Heyford, UK) as follows: purified protein mixtures were denatured and trypsinized using the FASP protocol to ensure efficient digestions and optimal recovery 49 . Peptide digests were analysed using a QExactive mass spectrometer (Thermo Scientific). Proteins were identified using the Trans Proteomics Pipeline and relative protein abundance was measured by label-free quantitative mass spectrometry using the Normalized Spectral Index SIN (ref. 50 ). The three-way comparison was carried out by using pooled data from the results of the individual analyses of each duplicate or quadruplicate vector preparation. The initial set of common proteins were retrospectively filtered by removing hits that varied by more than four-fold between replicate sample analyses of each vector type. The COX-2 protein data were manually included in the final ranking list, because it was not a common protein (not present in EIAV-GFP preparations).

Statistical analysis

Statistical analysis was performed by Welch's unequal variances t -test (two-tailed, type 3) using log 10 -transformed data. P <0.05 was considered to be significant.

Data availability

The authors declare that the data supporting the findings of this study are included within the article and its Supplementary Information file, or are available from the authors on request, subject to a confidentiality agreement.

Additional information

How to cite this article: Maunder, H. E. et al . Enhancing titres of therapeutic viral vectors using the transgene repression in vector production (TRiP) system. Nat. Commun. 8, 14834 doi: 10.1038/ncomms14834 (2017).

Publisher’s note : Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Muhlebach, M. D. et al. in Retroviruses: Molecular Biology, Genomics and Pathogenesis (eds Kurth, R. and Bannert, N.) Ch. 13, 347–370Caister Academic Press (2010).

Antoniou, M. N., Skipper, K. A. & Anakok, O. Optimizing retroviral gene expression for effective therapies. Hum. Gene Ther. 24 , 363–374 (2013).

Article CAS PubMed Google Scholar

Capasso, C. et al. The evolution of adenoviral vectors through genetic and chemical surface modifications. Viruses 6 , 832–855 (2014).

Article CAS PubMed PubMed Central Google Scholar

Kotterman, M. A. & Schaffer, D. V. Engineering adeno-associated viruses for clinical gene therapy. Nat. Rev. Genet. 15 , 445–451 (2014).

Morgan, R. A. & Kakarla, S. Genetic modification of T cells. Cancer J. 20 , 145–150 (2014).

Touzot, F., Hacein-Bey-Abina, S., Fischer, A. & Cavazzana, M. Gene therapy for inherited immunodeficiency. Expert Opin. Biol. Ther. 14 , 789–798 (2014).

Balaggan, K. S. & Ali, R. R. Ocular gene delivery using lentiviral vectors. Gene Ther. 19 , 145–153 (2012).

Katz, M. G. et al. Gene therapy delivery systems for enhancing viral and nonviral vectors for cardiac diseases: current concepts and future applications. Hum. Gene Ther. 24 , 914–927 (2013).

Coune, P. G., Schneider, B. L. & Aebischer, P. Parkinson’s disease: gene therapies. Cold Spring Harb. Perspect. Med. 2 , a009431 (2012).

Article PubMed PubMed Central Google Scholar

Pazarentzos, E. & Mazarakis, N. D. Anticancer gene transfer for cancer gene therapy. Adv. Exp. Med. Biol. 818 , 255–280 (2014).

Altenburg, A. F. et al. Modified vaccinia virus ankara (MVA) as production platform for vaccines against influenza and other viral respiratory diseases. Viruses 6 , 2735–2761 (2014).

Schirrmacher, V. & Fournier, P. Newcastle disease virus: a promising vector for viral therapy, immune therapy, and gene therapy of cancer. Methods Mol. Biol. 542 , 565–605 (2009).

Papadakis, E. D., Nicklin, S. A., Baker, A. H. & White, S. J. Promoters and control elements: designing expression cassettes for gene therapy. Curr. Gene Ther. 4 , 89–113 (2004).

Radcliffe, P. A. et al. Analysis of factor VIII mediated suppression of lentiviral vector titers. Gene Ther. 15 , 289–297 (2008).

Gollnick, P., Babitzke, P., Antson, A. & Yanofsky, C. Complexity in regulation of tryptophan biosynthesis in Bacillus subtilis . Annu. Rev. Genet. 39 , 47–68 (2005).

Babitzke, P., Stults, J. T., Shire, S. J. & Yanofsky, C. TRAP, the trp RNA-binding attenuation protein of Bacillus subtilis , is a multisubunit complex that appears to recognize G/UAG repeats in the trpEDCFBA and trpG transcripts. J. Biol. Chem. 269 , 16597–16604 (1994).

CAS PubMed Google Scholar

Babitzke, P., Yealy, J. & Campanelli, D. Interaction of the trp RNA-Binding attenuation protein (TRAP) of Bacillus subtilis with RNA: effects of the number of GAG repeats, the nucleotides separating adjacent repeats, and RNA secondary structure. J. Bacteriol. 178 , 5159–5163 (1996).

Elliot, M. B., Gottlieb, P. A. & Gollnick, P. Probing the TRAP-RNA interaction with nucleoside analogs. RNA 5 , 1277–1289 (1999).

Article Google Scholar

McAdams, N. M. & Gollnick, P. Characterization of TRAP-mediated regulation of the B. subtilis trp operon using in vitro transcription and transcriptional reporter fusions in vivo . Methods Mol. Biol. 259 , 333–347 (2015).

Nie, M. & Htun, H. Different modes and potencies of translational repression by sequence-specific RNA-protein interaction at the 5′-UTR. Nucleic Acids Res. 34 , 5528–5540 (2006).

Soboleski, M. R., Oaks, J. & Halford, W. P. Green fluorescent protein is a quantitative reporter of gene expression in individual eukaryotic cells. FASEB J. 19 , 440–442 (2005).

Merten, O.-W., Schweizer, M., Chahal, P. & Kamen, A. A. Manufacturing of viral vectors for gene therapy: part I. Upstream processing. Pharmaceut. Bioprocess. 2 , 183–203 (2014).

Hole, N. & Stern, P. L. Isolation and characterization of 5T4, a tumour-associated antigen. Int. J. Cancer 45 , 179–184 (1990).

Barraza, R. A. et al. Prostaglandin pathway gene therapy for sustained reduction of intraocular pressure. Mol. Ther. 18 , 491–501 (2010).

Saphire, A. C., Gallay, P. A. & Bark, S. J. Proteomic analysis of human immunodeficiency virus using liquid chromatography/tandem mass spectrometry effectively distinguishes specific incorporated host proteins. J. Proteome Res. 5 , 530–538 (2006).

Denard, J. et al. Quantitative proteomic analysis of lentiviral vectors using 2-DE. Proteomics 9 , 3666–3676 (2009).

Greco, G. et al. Matrix fibronectin increases HIV stability and infectivity. J. Immunol. 168 , 5722–5729 (2002).

Beer, C. & Pedersen, L. Matrix fibronectin binds gammaretrovirus and assists in entry: new light on viral infections. J. Virol. 81 , 8247–8257 (2007).

Kohlschütter, J., Michelfelder, S. & Trepel, M. Novel cytotoxic vectors based on adeno-associated virus. Toxins 2 , 2754–2768 (2010).

Wang, X. et al. R88-APOBEC3Gm inhibits the replication of both drug-resistant strains of HIV-1 and viruses produced from latently infected cells. Mol. Ther. Nucleic Acids 3 , e151 (2014).

Chan, E., Towers, G. J. & Qasim, W. Gene therapy strategies to exploit TRIM derived restriction factors against HIV-1. Viruses 6 , 243–263 (2014).

Cantin, R., Méthot, S. & Tremblay, M. J. Plunder and stowaways: incorporation of cellular proteins by enveloped viruses. J. Virol. 79 , 6577–6587 (2005).

Farley, D. C. et al. Factors that influence VSV-G pseudotyping and transduction efficiency of lentiviral vectors- in vitro and in vivo implications. J. Gene Med. 9 , 345–356 (2007).

Steer, S. A. & Corbett, J. A. The role and regulation of COX-2 during viral infection. Viral Immunol. 16 , 447–460 (2003).

Lee, E. J. et al. Cyclooxygenase-2 promotes cell proliferation, migration and invasion in U2OS human osteosarcoma cells. Mol. Med. 39 , 469–476 (2007).

CAS Google Scholar

Chen, H. Exploiting the intron-splicing mechanism of insect cells to produce viral vectors harboring toxic genes for suicide gene therapy. Mol. Ther. Nucleic Acids 1 , e57 (2012).

Cottingham, M. G. et al. Preventing spontaneous genetic rearrangements in the transgene cassettes of adenovirus vectors. Biotechnol. Bioeng. 109 , 719–728 (2012).

Strobel, B. et al. Riboswitch-mediated attenuation of transgene cytotoxicity increases adeno-associated virus vector yields in HEK-293 cells. Mol. Ther 23 , 1582–1591 (2015).

Heinicke, L. A. & Bevilacqua, P. C. Activation of PKR by RNA misfolding: HDV ribozyme dimers activate PKR. RNA 18 , 2157–2165 (2012).

Tabotta, W., Klein, D., Hohenadl, C., Salmons, B. & Günzburg, W. H. Genetic reshuffling reconstitutes functional expression cassettes in retroviral vectors. J. Gene Med. 3 , 418–426 (2001).

Brandtner, E. M. et al. Reconstituting retroviral (ReCon) vectors facilitating delivery of cytotoxic genes in cancer gene therapy approaches. J. Gene Med. 10 , 113–122 (2008).

Burke, J. D. & Morris, J. C. Retroviral vectors encoding a reverse transcription-activated transgene efficiently limit expression of the gene to target cells. Mol. Ther. 15 , 552–559 (2007).

Bagnis, C., Zwojsczyki, G., Chiaroni, J. & Bailly, P. Off-on polyadenylation strategy as a supplemental mechanism for silencing toxic transgene expression during lentiviral vector production. Biotechniques 56 , 311–312 (2014).

Palfi, S. et al. Long-term safety and tolerability of ProSavin, a lentiviral vector-based gene therapy for Parkinson's disease: a dose escalation, open-label, phase 1/2 trial. Lancet 383 , 1138–1146 (2014).

Rohll, J. B. et al. Design, production, safety, evaluation, and clinical applications of nonprimate lentiviral vectors. Methods Enzymol. 346 , 466–500 (2002).

Kim, V. N., Mitrophanous, K. A., Kingsman, S. M. & Kingsman, A. J. Minimal requirement for a lentivirus vector based on human immunodeficiency virus type 1. J. Virol. 72 , 811–816 (1998).

CAS PubMed PubMed Central Google Scholar

Kotsopoulou, E., Kim, V. N., Kingsman, A. J., Kingsman, S. M. & Mitrophanous, K. A. A Rev-independent human immunodeficiency virus type 1 (HIV-1)-based vector that exploits a codon-optimized HIV-1 gag-pol gene. J. Virol. 74 , 4839–4852 (2000).

Shaw, D. M. et al. Isolation of a high affinity scFv from a monoclonal antibody recognising the oncofoetal antigen 5T4. Biochim. Biophys. Acta 1524 , 238–246 (2000).

Wiśniewski, J. R., Zougman, A., Nagaraj, N. & Mann, M. Universal sample preparation method for proteome analysis. Nat. Methods 6 , 359–362 (2009).

Article PubMed Google Scholar

Griffin, N. M. et al. Label-free, normalized quantification of complex mass spectrometry data for proteomic analysis. Nat. Biotechnol. 28 , 83–89 (2010).

Download references

Acknowledgements

The authors would like to thank the team at Cytome Technologies for their work and helpful suggestions regarding the SINQ analysis.

Author information

T. T. Mkandawire

Present address: Present address: Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge CB10 1SA, UK,

Present address: Present address: AstraZeneca, Innovative Medicines and Early Development, Personalised Healthcare and Biomarkers, KC721/02, Pepparedsleden 1, 431 83 Mölndal, Sweden,

Authors and Affiliations

Research Department, Oxford BioMedica Ltd., Windrush Court, Transport Way, Oxford, OX4 6LT, UK

H. E. Maunder, J. Wright, B. R. Kolli, C. R. Vieira, T. T. Mkandawire, S. Tatoris, V. Kennedy, S. Iqball, G. Devarajan, S. Ellis, Y. Lad, N. G. Clarkson, K. A. Mitrophanous & D. C. Farley

You can also search for this author in PubMed Google Scholar

Contributions

D.C.F. conceived and directed the project (except the animal study of Supplementary Fig. 6 , which was directed by S.E.), wrote the manuscript and created display items, as well as generated the data in Figs 2b,c and 5 and Table 1 , Fig. 6e,f , and Supplementary Figs 5, 7, 8b . H.E.M. generated the data in Figs 4b and 6c,d , and Supplementary Fig. 4a–c. J.W. generated the data in Figs 2d and 3 , and Supplementary Figs 1 and 2 . B.R.K. developed the HeLa-TRAP cells, and generated the data in Fig. 6g and Supplementary Fig. 8c . C.R.V. generated the data in Supplementary Fig. 8h. H.E.M., S.T. and T.T.M. developed the HEK293T.TRiP cell lines. V.K. generated the data in Fig. 4d,e , and contributed equally with S.I. to generate Supplementary Fig. 6 . S.I. also generated the data in Supplementary Fig. 3 , and contributed to Supplementary Fig. 4d together with G.D. Y.L. generated the data in Fig. 4c . N.G.C. advised on SINQ analysis. K.A.M. advised and contributed to manuscript revisions.

Corresponding author

Correspondence to D. C. Farley .

Ethics declarations

Competing interests.

The work described was fully funded by Oxford BioMedica Ltd., and all authors at the time of submission, except T.T.M. and S.T., were employees and hold stock or stock options within the company.

Supplementary information

Supplementary information.

Supplementary Figures, Supplementary Methods and Supplementary References (PDF 1307 kb)

Peer Review File (PDF 623 kb)

Rights and permissions.

This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Reprints and permissions

About this article

Cite this article.

Maunder, H., Wright, J., Kolli, B. et al. Enhancing titres of therapeutic viral vectors using the transgene repression in vector production (TRiP) system. Nat Commun 8 , 14834 (2017). https://doi.org/10.1038/ncomms14834

Download citation

Received : 16 December 2016

Accepted : 03 February 2017

Published : 27 March 2017

DOI : https://doi.org/10.1038/ncomms14834

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

By submitting a comment you agree to abide by our Terms and Community Guidelines . If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Quick links

Explore articles by subject
Guide to authors
Editorial policies

Sign up for the Nature Briefing: Translational Research newsletter — top stories in biotechnology, drug discovery and pharma.

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Publications
Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

Advanced Search
Journal List
Int J Biol Sci
v.18(9); 2022

Inhibitory role of TRIP-Br1 oncoprotein in anticancer drug-mediated programmed cell death via mitophagy activation

Associated data.

Chemotherapy has been widely used as a clinical treatment for cancer over the years. However, its effectiveness is limited because of resistance of cancer cells to programmed cell death (PCD) after treatment with anticancer drugs. To elucidate the resistance mechanism, we initially focused on cancer cell-specific mitophagy, an autophagic degradation of damaged mitochondria. This is because mitophagy has been reported to provide cancer cells with high resistance to anticancer drugs. Our data showed that TRIP-Br1 oncoprotein level was greatly increased in the mitochondria of breast cancer cells after treatment with various anticancer drugs including staurosporine (STS), the main focus of this study. STS treatment increased cellular ROS generation in cancer cells, which triggered mitochondrial translocation of TRIP-Br1 from the cytosol via dephosphorylation of TRIP-Br1 by protein phosphatase 2A (PP2A). Up-regulated mitochondrial TRIP-Br1 suppressed cellular ROS levels. In addition, TRIP-Br1 rapidly removed STS-mediated damaged mitochondria by activating mitophagy. It eventually suppressed STS-mediated PCD via degradation of VDACI, TOMM20, and TIMM23 mitochondrial membrane proteins. TRIP-Br1 enhanced mitophagy by increasing expression levels of two crucial lysosomal proteases, cathepsins B and D. In conclusion, TRIP-Br1 can suppress the sensitivity of breast cancer cells to anticancer drugs by activating autophagy/mitophagy, eventually promoting cancer cell survival.

Introduction

Most anticancer drugs currently available target apoptosis. However, many malignant cancer cells have acquired resistance to apoptosis due to defective or absent apoptosis-related genes or signaling pathways, such as p53 mutations in many different types of cancer cells and the lack of caspase 3 in MCF7 breast cancer cell line. Determining novel targets is essential to increase the sensitivity of cancer cells to anticancer drugs. Targeting various types of PCD concurrently in addition to apoptosis is one of strategies to increase cancer cell sensitivity to anticancer drugs. Eukaryotic cells undergo more than 11 different types of PCD, including apoptosis, necrosis/necroptosis, and anoikis depending on the stimuli and environments 1 , 2 . All known types of PCD are interconnected via multiple signaling pathways, in which mitochondria play a vital regulatory role 3 . Thus, understanding the precise mechanism in mitochondria-mediated PCD would be important for controlling the resistance of cancer cells to anticancer drugs.

Toxicities of most chemotherapeutic agents are attributed to the induction of mitochondrial dysfunction 4 . Mitochondrial-mediated PCD induced by anticancer treatments is often associated with decreases of ATP production and mitochondrial membrane potential (MMP), and with an increase in reactive oxygen species (ROS) generation 5 - 14 . These changes can increase mitochondrial malfunction, triggering the release of pro-apoptotic proteins (such as cytochrome c) or pro-necroptotic proteins (such as CypA) from damaged mitochondria, eventually resulting in PCD. Therefore, rapid clearance of damaged mitochondria eventually inhibits PCD. Especially, intracellular ROS are major factors that decide cell fate 15 , 16 . ROS at low concentrations are required for cell survival by acting as signaling molecules. Higher ROS levels can cause mild oxidative stress, which removes damaged mitochondria for cell survival 17 . Further increase in ROS level can lead to apoptosis and sudden necrosis/necroptosis 9 , 18 - 21 .

Dysfunctional or damaged mitochondria can be removed mainly by mitophagy or mitoptosis (mitochondrial suicide) 22 . Mitophagy has been suggested to be highly activated in cancer cells in response to various stressful conditions 23 . Mitophagy is mediated by autophagy-related proteins and lysosomal components. Damaged mitochondria are engulfed by autophagosomes and eventually degraded by lysosomes. Many studies have proposed that mitophagy has a dual role: 1) mitophagy prevents tumorigenesis of normal cells by removing abnormal mitochondria and therefore protecting cells from disordered mitochondrial metabolism; and 2) mitophagy promotes survival of cancer cells by suppressing sensitivity to chemotherapy 22 , 24 - 26 . Therefore, targeting cancer-specific mitophagy might be a promising strategy to design effective chemotherapies. In fact, manipulating autophagy/mitophagy is currently considered as an attractive therapeutic strategy in cancer. However, its role in cancer remains unclear and strategies in cancer therapy remain confusing.

To elucidate the mechanism of cancer-specific mitophagy, we initially focused on TRIP-Br1 (also known as SERTAD1/SEI-1/SEI1/p34 SEI-1 ) protein. TRIP-Br1 is a member of TRIP-Br family proteins that share the N-terminal SERTA domain. Our preliminary data have revealed that TRIP-Br1 is localized to the nucleus, cytoplasm, and mitochondria 27 , where it exerts different cellular functions as a multifunctional protein. TRIP-Br1 is involved in transcriptional regulation, cell cycle, cell differentiation, senescence, and PCD regulation 27 - 39 . Overexpressed in many different types of cancer cells and cancer patients, TRIP-Br1 plays a critical role in tumorigenesis as an oncogene 30 . Our previous data have shown that TRIP-Br1 expression is greatly increased under different types of PCD-inducing stressful conditions, such as anticancer treatment, nutrient starvation, and hypoxia 27 , 40 . Up-regulated TRIP-Br1 suppresses three types of PCD, including apoptosis, necrosis/necroptosis, and anoikis 27 , 28 , 40 . For example, TRIP-Br1 inhibits apoptosis of breast cancer cells upon treatment with anticancer drugs (e.g., staurosporine, etoposide, and cisplatin) by stabilizing XIAP E3 ligase 28 . TRIP-Br1/XIAP also represses necroptosis under nutrient/serum starvation 40 . Our unpublished data showed that TRIP-Br1 also could suppress anoikis under three-dimentioanl suspended culture. Nevertheless, the exact mechanism involved in the effect of TRIP-Br1 on mitochondrial-mediated PCD remains unknown.

The current study shows that TRIP-Br1 oncogenic protein contributes to high cellular resistance to anticancer drug treatment via activation of mitophagy.

Mitochondrial distribution/sub-localization of TRIP-Br1 protein in normal breast and cancer cell lines

Our previous report has revealed that TRIP-Br1 protein is localized to the mitochondria of various cancer cell lines 27 , 28 . The current study also showed that TRIP-Br1 was more predominantly found in the mitochondria of human breast cancer (MCF7 and MDA-MB-231) and colon cancer (HCT116) cell lines than in a normal breast cell line (MCF10A) (Figures (Figures1 1 A- A-1B). 1 B). Similar results were obtained via immunofluorescence analysis, showing that endogenous mitochondrial TRIP-Br1 was co-localized with Mitotracker (Figure (Figure1C). 1 C). Next, mitochondrial TRIP-Br1 protein levels were further compared between MCF7 cancer and MCF10A normal cell lines. Although total levels of TRIP-Br1 protein were slightly higher in MCF7 cells, mitochondrial TRIP-Br1 levels were substantially higher in MCF7 cells than in MCF10A normal cells (Figures (Figures1 1 D- D-1E). 1 E). MCF10A normal cells showed substantially higher levels of TRIP-Br1 in cytosol than in mitochondria. In a further study, sub-localization of TRIP-Br1 in mitochondrial compartment was analyzed by adding proteinase K to mitochondrial fractionized sample of MCF7. Proteinase K treatment degraded TRIP-Br1 and VDAC1, a mitochondrial outer membrane protein, but not cytochrome c, a mitochondrial inner membrane protein, suggesting that TRIP-Br1 was accumulated in mitochondrial outer membrane (Figure (Figure1 1 F).

An external file that holds a picture, illustration, etc.
Object name is ijbsv18p3859g001.jpg

Subcellular distribution of TRIP-Br1 protein in normal breast or cancer cell line and mitochondrial localization of TRIP-Br1. A-B Indicated cell lines were used in mitochondrial fractionation as described in Materials and Methods. TRIP-Br1 protein level in each fraction was quantified via immunoblotting analyses. The following proteins were used as cellular markers: HSP60 as a mitochondrial marker, γ-tubulin as a cytosolic marker, and histone H3 as a nuclear marker. Amount of protein loaded: 15 µg for total protein, 2.5 µg for mitochondrial (Mito), and 15 µg for cytosolic (Cyto) fraction. Data are expressed as mean ± SD (n = 3; ***, p < 0.001). C Indicated four cell lines were stained with TRIP-Br1 (green) for 24 h, incubated with 1 µM of Mitotracker (red) for 30 min, and fixed with 4% paraformaldehyde. DAPI (blue) was used as a nuclear marker. Resulting cells were visualized with a confocal microscope. D-E MCF7 and MCF10A cell lines were cultured for 24 h and then used for mitochondrial fractionation. TRIP-Br1 protein level in each fraction was determined by western blot analysis. Data are presented as mean ± SD (n = 3; ***, p < 0.001). F Mitochondrial fraction from MCF7 cells was incubated with 50 μg/mL of proteinase K in the absence or presence of 1% Triton X-100 for 30 min. Samples were subjected to western blotting analysis.

Collectively, these data suggest the presence of a significant amount of TRIP-Br1 protein in mitochondria of cancer cells, mainly localized in the outer membrane.

ROS-triggered TRIP-Br1 translocation into mitochondria and TRIP-Br1-mediated ROS suppression in response to anticancer drug treatment

TRIP-Br1 protein levels in mitochondria after treatment with three different anticancer drugs were analyzed using the MCF7 cell line, a well-known cancer cell line that is highly resistant to many types of anticancer drugs 2 . TRIP-Br1 protein levels were increased significantly in the mitochondria after treatment with all three anticancer drugs even only after a short-term exposure (2~5 h) (Figure (Figure2A). 2 A). Especially, staurosporine (STS) greatly increased TRIP-Br1 protein levels in the mitochondria, but not total cellular protein levels of TRIP-Br1 (Figures (Figures2 2 A- A-2B). 2 B). In fact, the mRNA level of TRIP-Br1 was not changed after 4 h treatment with anticancer drugs (Figure (Figure2C), 2 C), suggesting mitochondrial translocation of existing TRIP-Br1 rather than de novo synthesis of TRIP-Br1 after a short exposure to STS.

An external file that holds a picture, illustration, etc.
Object name is ijbsv18p3859g002.jpg

Up-regulated TRIP-Br1 protein level in mitochondria in response to anticancer drug treatment and TRIP-Br1-mediated ROS suppression in cancer cells. A MCF7 cells were treated with three different anticancer drugs for indicated time periods and concentrations, followed by mitochondrial fractionation. B MCF7 cells were treated with STS at different concentrations (0.01~1 μM) for 90 min followed by mitochondrial fractionation. C MCF7 cells were treated with 0.1 μM of STS for 4 h. Reverse transcription (RT)-PCR analysis was performed with TRIP-Br1-specific primer pairs (See Materials and Methods) using β-actin as an internal control. D-F MCF7 cells (1×10 6 ) were cultured for 24 h and intracellular levels of ATP, MMP, and ROS were measured as indicated in Materials and Methods. Results are presented as mean ± SD (n = 5). G-I MCF7 and MCF10A cells were cultured for 24 h and then treated with STS or H 2 O 2 at indicated concentrations or time periods. Resulting cells were used for mitochondrial fractionation and ROS measurement. J-K Cells were pre-incubated with or without NAC, an ROS scavenger, for 30 min (5 mM for MCF7 and 1 mM for MDA-MB-231) and then treated with 0.1 μM of STS for 45 min. Each fraction of sample lysate was subjected to western blotting analysis. ROS levels were measured with the same sample. L-M MCF7 cells were treated with 0.1 μM of STS for 3 h. Cellular ROS ( L ) or mitochondrial ROS ( M ) levels were then measured. Data are presented as mean ± SD (n = 6).

Next, we investigated the trigger of TRIP-Br1 translocation into mitochondria and the role of TRIP-Br1 in the mitochondria of cancer cells upon treatment with anticancer drugs. To this end, we first determined the effect of TRIP-Br1 on three representative mitochondrial functions. TRIP-Br1 knock-downed MCF7 (MCF7 KD-TRIP-Br1 ) cells showed slightly lower levels of ATP and MMP, but higher ROS levels than TRIP-Br1 wild-type MCF7 (MCF7 WT-TRIP-Br1 ) cells (Figures (Figures2 2 D- D-2F). 2 F). Anticancer treatment is known to induce substantially higher levels of ROS in cancer cells. However, some malignant cells can overcome this ROS stress. Thus, we initially focused on intracellular ROS contents. MCF7 cells were treated with 0.1 μg/mL of STS for 6 h. Intracellular ROS content was then evaluated. Interestingly, mitochondrial TRIP-Br1 expression was increased following the accumulation of ROS (Figure (Figure2G). 2 G). However, levels of both mitochondrial TRIP-Br1 expression and ROS in MCF10A normal cells did not change after STS treatment (Figure (Figure2H). 2 H). MCF10A cells did not respond to treatment with H 2 O 2 (a major ROS contributor) either (Figure (Figure2I). 2 I). These data indicate that mitochondrial TRIP-Br1 protein levels are more sensitive to cellular ROS levels in cancer cells, implying that ROS might trigger mitochondrial translocation of TRIP-Br1 in cancer cells. This possibility was further tested using MCF7 and MDA-MB-231 cell lines treated with NAC, an ROS scavenger, as well as STS. Interestingly, a reduced mitochondrial TRIP-Br1 level was found in cells treated with both STS and NAC than in cells treated with STS alone (Figures (Figures2 2 J- J-2K). 2 K). A further study showed substantially higher levels of cellular and mitochondrial ROS in TRIP-Br1 suppressed MCF7 cells under both basal conditions and upon STS exposure (Figures (Figures2L-2M), 2 L-2M), suggesting that TRIP-Br1 could suppress cellular ROS levels in cancer cells.

Taken together, these findings suggest that STS treatment could elevate ROS production, which induces mitochondrial translocation of TRIP-Br1 to suppress ROS generation in cancer cells.

Mitochondrial translocation of TRIP-Br1 via dephosphorylation by protein phosphatase 2A (PP2A)

Next, we investigated the mechanism of TRIP-Br1 translocation into mitochondria. Using a protein localization prediction program (TargetP 1.1 Server), TRIP-Br1 showed a low possibility of independent mitochondrial localization because TRIP-Br1 did not contain a mitochondrial target sequence (MTS) ( Supplementary Figure 1 ). Instead, we hypothesized that it might be mediated via post-translational modification (PTM) because many different types of PTM are strongly related to sub-cellular re-localization. Interestingly, our Phos-tag SDS-PAGE analysis revealed phosphorylated and dephosphorylated forms of TRIP-Br1 compared with conventional SDS-PAGE after STS treatment (Figure (Figure3A). 3 A). Further tests showed that the TRIP-Br1 phosphorylated form was present in the cytosol, whereas the dephosphorylated form existed in the mitochondria (Figure (Figure3B). 3 B). We also hypothesized that TRIP-Br1 might be dephosphorylated by PP2A. It has been proposed that PP2A can dephosphorylate TRIP-Br1 and stabilize its expression 41 . In addition, PP2A can be activated via oxidative stress such as high ROS generation to participate in many signaling pathways of mammalian cells 42 - 47 . In fact, our mitochondrial fractionation experiment showed that TRIP-Br1 translocation into mitochondria was blocked when cells were treated with okadaic acid, a PP2A specific inhibitor (Figure (Figure3C) 3 C) 48 , 49 . Our hypothesis was further tested in U2OS 4.3 osteosarcoma cells, in which TRIP-Br1 expression could be induced by doxycycline 50 . Treatment with doxycycline only induced higher levels of mitochondrial TRIP-Br1, whereas treatment with both doxycycline and okadaic acid remarkably decreased levels of mitochondrial TRIP-Br1 (Figure (Figure3D). 3 D). Immunofluorescence data also showed that TRIP-Br1 protein levels were decreased significantly in mitochondria after okadaic acid treatment (Figure (Figure3E). 3 E). In contrast, C 2 -ceramide, a potent activator of PP2A 51 , 52 , enhanced mitochondrial translocation of TRIP-Br1 after treatment (Figure (Figure3 3 F).

An external file that holds a picture, illustration, etc.
Object name is ijbsv18p3859g003.jpg

Mitochondrial translocation of TRIP-Br1 via PP2A-mediated dephosphorylation upon STS treatment. A Phosphorylation status of TRIP-Br1 was analyzed using a Phos-tag SDS-PAGE gel. Lysates of MCF7 cells were prepared and then exposed to CIP for 1 h at 37°C, followed by 8 % SDS-PAGE with 20 μM of phos-tag and immunoblotting analysis. Conventional SDS-PAGE was also performed with the same lysate as a control. B MCF7 cells were treated with 0.1 μM STS for 90 min followed by subcellular fractionation. Fractionated samples were subjected to Phos-tag SDS-PAGE. C MCF7 cells were treated with STS (0.1 μM) and/or okadaic acid (50 nM) for 3 h. Fractionated samples were subjected to western blot analysis. D U2OS 4.3 osteosarcoma cells were pre-incubated with or without doxycycline (1 μg/mL) to induce TRIP-Br1 expression for 24 h before treatment with okadaic acid (50 nM) for 24 h. E MCF7 cells were treated with okadaic acid (50 nM) for 16 h and incubated with Mitotracker (red) for 30 min. TRIP-Br1 (green) and Mitotracker (red) were visualized under a fluorescence microscope. F MCF7 cells were exposed to C 2 -Ceramide (10 μM) in a time-dependent manner followed by mitochondrial fractionation.

Collectively, these data strongly suggest that translocation of TRIP-Br1 into mitochondria is induced by PP2A-mediated dephosphorylation upon anticancer treatment, at least partly.

TRIP-Br1-mediated PCD suppression in cancer cells via induction of autophagy

It is known that cancer cells usually produce significant amounts of ROS following anticancer treatment, which usually trigger mitochondrial damage and enhance the toxicity to cancer cells. Our data also showed that STS treatment enhanced ROS levels, whereas TRIP-Br1 suppressed cellular ROS generation and finally PCD in cancer cells. Therefore, we hypothesized that TRIP-Br1 could repress cellular ROS generation by inducing mitophagy for rapid clearance of damaged mitochondria. Thus, we evaluated effects of TRIP-Br1 on autophagy and mitophagy.

At first, effects of TRIP-Br1 on autophagy and PCD were analyzed using MCF7 TRIP-Br1-WT and MCF7 TRIP-Br1-KD cells following a short-term (3 h) and a long-term (24 h) exposure to STS (0.1 and 0.5 μg/mL). While short-term treatment with STS (3 h) induced translocation of TRIP-Br1 into mitochondria (Figure (Figure2B), 2 B), long-term exposure to STS (24 h) slightly increased TRIP-Br1 protein level (Figures (Figures4 4 A- A-4B). 4 B). MCF7 WT-TRIP-Br1 cells showed higher conversion ratio from LC3-I to LC3-II, but lower cleaved PARP level upon treatment with 0.1 µM STS for 24 h, implying that highly activated autophagy might repress apoptosis. Substantially lower levels of LC3 and PARP proteins were detected in MCF7 KD-TRIP-Br1 cells treated with 0.5 µM STS due to a very high level of cell death (Figures (Figures4 4 A- A-4 4 C).

An external file that holds a picture, illustration, etc.
Object name is ijbsv18p3859g004.jpg

Suppression of STS-mediated cell death by TRIP-Br1 via induction of autophagy . A-B MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells were cultured for 24 h and then treated with 0.1 or 0.5 µM of STS for 3 h or 24 h. Western blot was performed and β-actin was used as a loading control. Data are presented as mean ± SD (n = 3; **, p < 0.01, ***, p < 0.001). C MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells were cultured in 100 mm culture dishes for 24 h and then treated with 0.1 or 0.5 µM of STS for 3 h or 24 h, respectively. Cell morphology was observed using an optical microscope with an IS capture software (KI-400F; Korea Lab Tech, Seongnam, South Korea) at ×100 magnification. The experiment was repeated three times. Images represent the average cell morphology. D MCF7 WT-TRIP-Br1 and MCF7KD-TRIP-Br1 cells were pretreated with CQ (100 mM) for 6 h, followed by STS treatment at indicated concentrations for 24 h. Cell viability was measured using a CellTiter-Glo 3D cell viability assay kit. Data are expressed as mean ± SD (n = 4). E Morphological changes in MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells were observed after treatment with CQ (100 mM) for 24 h, followed by STS (0.1 μM) treatment for 24 h. F MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells were pre-treated with CQ (100 mM) for 3 h, followed by STS (0.1 μM) treatment for 24 h. Each protein level was detected via immunoblotting using corresponding antibody.

To test whether TRIP-Br1 could suppress STS-induced PCD via induction of active autophagy, autophagy was blocked using chloroquine (CQ), a well-known inhibitor of autophagy 53 . Substantially higher levels of MCF7 WT-TRIP-Br1 cells were viable than MCF7 KD-TRIP-Br1 cells following treatment with only STS (Figure (Figure4D). 4 D). However, cell viability was decreased dramatically for MCF7 WT-TRIP-Br1 cells upon treatment with both STS and CQ. For MCF7 KD-TRIP-Br1 cells, a similar lower level of cell viability was detected regardless of CQ treatment (Figure (Figure4D). 4 D). Morphological analysis also yielded the same results (Figure (Figure4E). 4 E). Western blot analysis revealed substantially lower levels of cleaved PARP in MCF7 WT-TRIP-Br1 cells than in MCF7 KD-TRIP-Br1 cells after STS treatment. However, levels of cleaved PARP were greatly increased by combined treatment of both STS and CQ (Figure (Figure4F). 4 F). Again, PARP cleavage in MCF7 KD-TRIP-Br1 cells did not change drastically between before and after CQ treatment (Figure (Figure4 4 F).

These data strongly indicate that TRIP-Br1 can suppress PCD by activating autophagy.

TRIP-Br1-mediated PCD suppression in cancer cells via induction of mitophagy

Next, the effect of TRIP-Br1 on mitophagy progression was evaluated using early and advanced mitophagy markers to indicate the degradation of mitochondrial proteins residing in outer (VDAC1 and TOMM20) and inner (TIMM23) membranes, respectively. It has been proposed that mitochondrial outer membrane (MOM) proteins are degraded by proteasome prior to the induction of mitophagy. These proteins are known as early mitophagy markers 54 . Our data showed that two early mitophagy markers (VDACI and TOMM20) and one advanced mitophagy maker (TIMM23) were substantially lower in MCF7 WT-TRIP-Br1 cells than in MCF7 KD-TRIP-Br1 cells upon STS treatment (Figures (Figures5 5 A- A-5B). 5 B). However, no major difference existed between MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells after combined treatment with STS and CQ (Figures (Figures5 5 A- A-5B). 5 B). Levels of mitochondrial membrane proteins were significantly higher in MCF7 KD-TRIP-Br1 cells regardless of treatment with CQ (Figures (Figures5 5 A- A-5B). 5 B). Expression levels of heat shock protein 60 (HSP60, a mitochondrial matrix protein) and heat shock protein family A (HSP70) member 9 (HSPA9/GRP75, a mitochondrial associated membrane (MAM) protein) as control proteins were not altered by STS treatment. Their levels in MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells showed no substantial differences either (Figure (Figure5A). 5 A). These data suggest the delayed degradation of mitochondrial membrane proteins and therefore a significant impairment of mitochondrial clearance in MCF7 KD-TRIP-Br1 cells upon STS treatment.

An external file that holds a picture, illustration, etc.
Object name is ijbsv18p3859g005.jpg

Suppression of STS-mediated cell death by TRIP-Br1 via induction of mitophagy. A-B MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells were pre-treated with CQ (100 mM), followed by STS (0.1 μM) for 24 h. Each protein level was detected via immunoblotting using the corresponding antibody. C-D MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells were cultured in the absence or presence of STS (0.1 μM) for 3 h. Resulting cells were used for mitochondrial fractionation and western blotting analysis as mentioned in Materials and Methods. Data are expressed as mean ± SD (n = 3; **, p < 0.01; ***, p < 0.001). E Relative quantification of mtDNA amount in MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells was performed using real-time (RT)-PCR. Cells were pre-treated with or without 100 mM CQ for 6 h and then treated with 0.1 µM STS for 24 h. Relative mtDNA levels were normalized to GAPDH and a graphical representation of the summary data is presented. Data are expressed as mean ± SD (n = 3). F MCF7 WT-TRIP-Br1 and MCF7KD-TRIP-Br1 cells were grown in confocal dishes for 24 h. These cells were incubated with STS (0.1 μM) or CQ (100 mM) for 6 h. They were then incubated with 1 µM of Mitotracker dye for 30 min. Cells were stained with LC3 (yellow) and Mitotracker (red). Representative fluorescent images were visualized with a confocal microscope (scale bars, 20 μM). The co-localization of mitochondria and LC3 was measured by counting more than 100 cells in ImageJ per experiment for each group. Data represent the mean value of three independent experiments. H-I TRIP-Br1 wild-type MEF (MEF WT-TRIP-Br1 ) and TRIP-Br1-null MEF (MEF KO-TRIP-Br1 ) were cultured in confocal dishes for 24 h, followed by staining with Mitotracker (100 nM) for 30 min. Representative fluorescent images were visualized under an immunofluorescence microscope (scale bars, 20 μm). Mitochondria intensity with red staining was quantified using ImageJ.

Mitochondrial fractionation data also showed that protein levels of three mitochondrial membrane proteins (VDAC1, TOMM20, and TIMM23) were substantially lower in the mitochondria of MCF7 WT-TRIP-Br1 cells than in the mitochondria of MCF7 KD-TRIP-Br1 cells for both control and test samples subjected to a short-term treatment with 0.1 µM STS (Figures (Figures5 5 C- C-5D). 5 D). Expression levels of these three mitochondrial proteins were greatly decreased in the mitochondria of MCF7 WT-TRIP-Br1 cells, but only slightly decreased in the mitochondria of MCF7 KD-TRIP-Br1 cells following a short-term exposure to 0.1 µM STS (Figures (Figures5 5 C- C-5D). 5 D). We consistently observed significantly higher levels of these proteins in MCF7 KD-TRIP-Br1 cells than in MCF7 WT-TRIP-Br1 cells in the absence or presence of STS. Again, HSP60 and HSPA9/GRP75 protein levels in MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells showed no significant differences (Figure (Figure5C). 5 C). These findings suggest that TRIP-Br1 can strongly activate mitophagy upon STS treatment.

These findings were further reinforced by monitoring mitochondrial mass. The relative quantification of mtDNA levels upon STS treatment was achieved using real-time (RT)-PCR (Figure (Figure5E). 5 E). A markedly reduced mtDNA level was found in MCF7 WT-TRIP-Br1 cells than in MCF7 KD-TRIP-Br1 cells upon STS treatment as well as in basal conditions. However, mtDNA level was increased by combined treatment with CQ and STS (Figure (Figure5E). 5 E). It was found that mtDNA level was also decreased in MCF7 KD-TRIP-Br1 cells after STS treatment, showing no significant difference between before and after CQ treatment (Figure (Figure5E). 5 E). It has been suggested that reduced mtDNA level can attenuate the respiratory chain, resulting in decreased ROS production 55 . This suggestion is consistent with our data showing higher ROS levels in TRIP-Br1 suppressed MCF7 cells. Co-immunofluorescence analysis also revealed a higher co-localization of mitochondria and LC3 in MCF7 WT-TRIP-Br1 cells than in MCF7 KD-TRIP-Br1 cells upon STS treatment, suggesting higher levels of mitophagy in wild-type TRIP-Br1 expressing MCF7 cells (Figures (Figures5 5 F- F-5 5 G).

Our in vitro data showed fewer mitochondria in MCF7 WT-TRIP-Br1 cells than in MCF7 WT-TRIP-Br1 cells even in the control group probably due to a higher basal level of mitophagy in MCF7 WT-TRIP-Br1 cells ( Supplementary Figure 2 ). Consistent with our in vitro data, a similar result was obtained with MEF cells isolated from TRIP-Br1 wild-type (MEF WT-TRIP-Br1 ) and knock-out mice (MEF KO-TRIP-Br1 ). Lower levels of mitochondria were detected in MEF WT-TRIP-Br1 cells than in MEF KD-TRIP-Br1 cells under a fluorescence microscope (Figures (Figures5 5 H- H-5I). 5 I). However, CQ treatment induced the accumulation of mitochondria in MEF WT-TRIP-Br1 . Again, no difference was detected in MEF KD-TRIP-Br1 cells regardless of CQ. These data suggest higher levels of mitophagy in MEF WT-TRIP-Br1 than in MEF KD-TRIP-Br1 cells. TRIP-Br1 knock-out was confirmed by PCR ( Supplementary Figure 3 ).

Collectively, these findings suggest that TRIP-Br1 can strongly activate mitophagy upon STS treatment.

Enhanced TRIP-Br1-mediated mitophagy via up-regulation of lysosomal proteins, cathepsins B and D

Lysosome is a vital cellular organelle in the mitophagy process 56 . Lysosome contains 11 cathepsins, the most abundant and essential lysosomal proteases. Of all lysosomal proteases, the most abundant cathepsins B and D are highly overexpressed in breast cancer cells to regulate breast cancer cell growth and metastasis 57 , 58 . Therefore, we investigated the effect of TRIP-Br1 on lysosomal function in terms of cathepsins. Markedly higher levels of cathepsins B and D proteins were detected even in the control (Figures (Figures6 6 A- A-6B). 6 B). Their levels were increased substantially, whereas lower levels of cleaved PARP were found in TRIP-Br1 wild-type cells than in TRIP-Br1 knock-downed cells after 24 h of STS treatment (Figures (Figures6 6 A- A-6B). 6 B). However, lysosomal membrane protein LAMP-1 levels were increased to a similar extent in both cell lines (MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells) after STS treatment (Figures (Figures6 6 A- A-6B). 6 B). In addition, no significant difference was found in the intensity of lysotracker between MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells, implying not much difference in the number or the size of lysosomes between the two cell lines (Figure (Figure6 6 C).

An external file that holds a picture, illustration, etc.
Object name is ijbsv18p3859g006.jpg

Enhanced TRIP-Br1-mediated mitophagy via up-regulation of lysosomal proteases cathepsins B and D. A-B MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells were treated with 0.1 µM STS for 3 h and 24 h. The precursor and mature forms of cathepsins B and D were determined via immunoblotting analysis. β-actin was used as an internal control. Data are presented as mean ± SD (n = 3). C MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells were cultured in confocal dishes for 24 h and then incubated with Lysotracker (Red) for 90 min. These cells were captured using a confocal microscope. Quantification of red fluorescence intensity of Lysotracker is shown. Values are expressed as mean ± SD of three independent experiments with each count of no less than 100 cells. D Both cell lines were cultured for 24 h and then treated with 0.1 μM STS for 3 h. Cells were harvested and lysosomal fractions were isolated as described in Materials and Methods. γ -Tubulin was used as a cytosolic marker.

Lysosome enriched fractionation experiment also revealed significantly higher levels of cathepsins B and D in both total and lysosomal fractionations of MCF7 WT-TRIP-Br1 cells compared with those of MCF7 KD-TRIP-Br1 cells (Figure (Figure6D). 6 D). Notably, the adopted lysosome enriched fraction contained autophagolysosome as well as pure lysosome. The crude lysosomal fraction still contained portions of mitochondria, suggesting basal level of mitophagy. Therefore, mitochondrial proteins (VDAC1, TOMM20, and TIMM23) were also found in lysosome-enriched fractions of both MCF7 WT-TRIP-Br1 and MCF7 KD-TRIP-Br1 cells based on the detection of only LC3-II, but not LC3-I in lysosome-enriched fractions in control groups as well as in STS-treated groups. An inverse relationship was found between mitochondrial marker proteins and the expression of cathepsins B or D (Figure (Figure6 6 D).

Our findings demonstrate that TRIP-Br1 appears to enhance mitophagy at least via up-regulation of cathepsins B and D under both control and STS-treated conditions.

Targeting cancer cell-specific autophagy/mitophagy may facilitate the development of novel strategies for the treatment of various types of cancer. Our results may provide one clue to target autophagy/mitophagy mechanisms in cancer research. We found that up-regulated mitochondrial TRIP-Br1 inhibited STS-mediated PCD of breast cancer cells by inducing mitophagy, at least partly.

A further study is needed to analyze the function of TRIP-Br1 in lysosomes, one of key players in mitophagy. Lysosome not only suppresses tumorigenesis in normal cells, but also shows oncogenic characteristics in cancer cells. Lysosome can induce anticancer drug resistance by blocking chemotherapeutic drugs from reaching their cellular targets 59 . Cathepsins play a vital role in the degradation of intracellular proteins and organelles. In cancer cells, overexpression of cathepsins can promote cell migration, proliferation, invasion, and metastasis 56 , 57 , 60 . Many studies have shown that lysosomal membrane permeability (LMP) can induce PCD and that LMP is strongly correlated with cancer. PCD stimulating stress factors such as ROS and anticancer drugs can induce LMP, which then triggers the release of cathepsins from the lysosomal lumen into the cytosol, thereby activating caspases. Cathepsins B and D can cleave Bid and induce its proteolytic activation, followed by induction of MOMP, resulting in cytochrome c release and apoptosome-dependent caspase activation. Thus, TRIP-Br1 may suppress LMP and PCD eventually by blocking lysosomal release of cathepsins B and D into the cytoplasm. This hypothesis needs to be further tested.

Degradation of outer or inner mitochondrial membrane can trigger mitophagy. We and others have shown that TRIP-Br1 is responsible for the ubiquitination and degradation of membrane proteins in conjunction with E3 ligases (XIAP, NEDD4-1) 28 , 34 . Therefore, it would be interesting to test whether mitochondrial relocalization of TRIP-Br1 upon anticancer treatment can induce ubiquitination and degradation of MOM and MIM (e.g., VDAC1, TOMM20, TIMM23) in combination with unknown E3 ligases. In fact, we found that TRIP-Br1 positively regulated the expression of PARKIN, a vital E3 ligase in mitophagy. However, direct interaction between TRIP-Br1 and PARKIN was not detected (data not shown).

Defective mitochondria can be eliminated via mitoptosis and mitophagy, especially when mitophagy is inhibited. TRIP-Br1 might also be involved in mitoptosis. Mitoptosis involves both inner and outer mitochondrial membranes. During “inner mitochondrial membrane mitoptosis”, only the internal matrix and cristae are degraded, while the outer mitochondrial membrane remains intact 61 . Our data revealed that a substantially lower level of TIMM23 was detected in MCF7 WT-TRIP-Br1 cells after STS treatment, implying a possible induction of inner membrane mitoptosis.

In a further study, we tried to find out the phosphorylation site in TRIP-Br1 by making single point mutations of TRIP-Br1 protein. We and Zang et al. have predicted potential phosphorylaton sites (7 serine and 1 tyrosine) using bionformatic tools 41 . Our data showed that all mutation did not induce an increase of TRIP-Br1 in mitochondria upon STS treatment ( Supplementary Figure 4 ). However, we could not exclude the possibility of three-dimentinal distortion of TRIP-Br1 due to single amino acid change, which might affect TRIP-Br1 translocation. Thus, the exact phosphorylation site(s) responsible for TRIP-Br1 tranlocation needs to be discovered in the future.

Our current studies imply that TRIP-Br1 oncoprotein represents a possible candidate targeting cancer-specific mitophagy when combined with anticancer drugs to efficiently kill cancer cells.

Materials and Methods

Cell lines, cell culture, and cell treatment.

All cancer cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM; WelGENE, Korea) supplemented with 10% fetal bovine serum (FBS) (Gibco BRL) and 1% antibiotic-antimycotic solution (Gibco BRL, Cat#15240-062). A normal human MCF10A mammary epithelial cell line was grown as described elsewhere 27 . All cells were maintained at 37°C in a humidified atmosphere with 95% air and 5% CO 2 . MCF7 and MDA-MB-231 human breast cancer cell lines were purchased from the American Type Culture Collection (ATCC). MCF7 cell lines with wild-type or knock-down TRIP-Br1 were established in our previous study 27 . U2OS 4.3, a TRIP-Br1-inducible osteosarcoma cell line, was a kind gift from Dr. Rikiro Fukunaga (Kyoto University, Japan). Other reagents used in this study included staurosporine (STS) (A.G. Scientific, S-1016), chloroquine (CQ)(Sigma-Aldrich, C6628), okadaic acid (A.G. Scientific, O-1028), and C 2 -ceramide (Enzo Life science, BML-SL100).

Cell viability analysis

Cell viability was analyzed using a CellTiter-Glo® 3D Cell Viability Assay (Promega, G9681), according to the manufacturer's instructions. Briefly, cells (2 × 10 4 cells/well) were cultured in 96-well plates and then exposed to STS at indicated concentrations and time periods. These cells were vigorously mixed with a CellTiter-Glo 3D reagent for 5 min and incubated at room temperature for 30 min to stabilize luminescence. Cell viability was assessed by measuring the absorbance at luminescence in a GloMax® Discover (Promega). The analysis was conducted in triplicate.

Western blot analysis

Western blot was performed as described in our previous study 27 . Antibodies employed in this study were: anti-TRIP-Br1 (Enzo Life Sciences, ALX-804-645), anti-PARP (Cell Signaling Technology, #9542S), anti-cytochrome c (Santa Cruz Biotechnology, sc-7159), anti-CypA (Enzo Life Sciences, BML-SA296), anti-LC3 (Cell Signaling Technology, #2775S), anti-VDAC1 (Cell Signaling Technology, #4661), anti-TOMM20 (BD biosciences, 612278), anti-TIMM23 (BD biosciences, 611222), anti-HSP60 (Santa Cruz Biotechnology, sc-139661), anti-HSP70/GRP75 (Santa Cruz Biotechnology, sc-13967), anti-cathepsin B (Bioworld, BS3536), anti-cathepsin D (Bioworld, BS90201), anti-LAMP1 (Santa Cruz Biotechnology, sc-20011), anti-rabbit (Cell Signaling Technology, #7074S), and anti-mouse (Santa Cruz Biotechnology, sc-516102). Antibodies against γ-tubulin (Santa Cruz Biotechnology, sc-7396) and β-actin (Santa Cruz Biotechnology, sc-47778) were used to measure levels of γ-tubulin and β-actin as loading controls. Results of western blot analysis were semi-quantified using ImageJ software (ver. 1.51u; National Institutes of Health, USA). The relative intensity was compared to γ-tubulin or β-actin level and presented as bar graphs.

Mitophagy assessment

Mitophagy progression was calculated by monitoring the disappearance of mitochondrial membrane proteins (VDAC1, TOMM20 and TIMM23) and counting mitochondrial DNA (mtDNA) content via real-time PCR 62 . The degradation of VDAC1 and TOMM20 was used to monitor early mitophagy, whereas TIMM23 expression was used to determine advanced mitophagy 62 .

Real-time polymerase chain reaction (RT-PCR) for mtDNA determination

Mitochondrial DNA was quantified by extracting total DNA using a HiYield Plus TM Genomic DNA Mini Kit (Real Biotech Corporation, #QBT100). Rsulting mtDNAs were quantified using a 2×SYBR Green PCR master mix (ThermoFisher, #4367659) on a StepOnePlus™ (Applied Biosystems) with the following primers: mtDNA-(FW) 5'-AGGACAAGAGAAATAAGGCC-3'/(REV)5'-TAAGAAGAGGAATTGAACCTCTGACTGTAA-3'. GAPDH-(FW) 5'-CTGGGCTACACTGAGCACCAG-3'/(REV) 5'-CCAGCGTCAAAGGTGGAG-3'.

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted with an RNeasy Minikit (Qiagen, Cat. 74106, Germany) following the manufacturer's instructions. For reverse transcription, 1 μg RNA of each sample was subjected to cDNA synthesis using an ImProm-II™ Reverse Transcription System (Promega, #A3800). PCR amplification was performed using an AccuPower PCR PreMix system (Bioneer, Korea). Each gene product was amplified using the following primer pairs: TRIP-Br1 cDNA-(FW) 5'-AGGACCTCAGCCACATTGAG-3' and (REV) 5'-GGTGCCCAAAGTTCATTGTC-3'. ACTB cDNA (FW) 5'-CCATCGAGCACGGCATCGTCACCA-3'/(REV) 5'-CTCGGTGAGGATCTTCATGAGGTAGT-3'.

Measurement of cellular ATP

Cellular ATP levels were measured using a luminescent ATP detection assay kit (Abcam, ab113849) according to the manufacturer's protocol. ATP levels were measured by detecting luminescence using a GloMax® Discover multimode microplate reader (Promega Corporation, Madison, WI, USA).

Measurement of mitochondrial membrane potential (MMP)

MMP was determined using a Mito-ID Membrane Potential Cytotoxicity kit (cat. No. ENZ-51019; Enzo Life Sciences) according to the manufacturer's instruction. The MMP was measured based on the resulting fluorescence with a Gemini XPA microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 590 nm.

Measurement of reactive oxygen species (ROS)

ROS were measured with a Gemini XPA microplate reader as previously described 27 .

Mitochondrial fractionation

Cells were collected into 15 mL conical tubes after centrifugation at 1000 rpm for 5 min, washed with ice-cold PBS, resuspended with hypotonic lysis buffer (220 mM mannitol, 10 mM HEPES, 2.5 mM PO 4 H 2 K, 1 mM EDTA, 68 mM sucrose, and 1 mM PMSF), stored on ice for 10 min, and then centrifuged at 1000 rpm for 5 min at 4°C. Cell pellets were resuspended in the hypotonic lysis buffer and gently pipetted approximately 10-20 times every 15 min during 1 h incubation on ice, followed by centrifugation at 1500-2000 rpm for 5 min at 4°C to remove cellular debris. The supernatant was transferred to a fresh tube and centrifuged at 14,000 rpm for 5 min at 4°C. The supernatant and pellet represent cytosolic and mitochondrial fractions, respectively. Pellets were resuspended with RIPA buffer and used in western blot analysis.

Preparation of lysosomal fractionations

Lysosomes were isolated emplyoing a lysosome isolation kit (Abcam, #ab234047) following the manufacturer's protocol. Briefly, cells were collected into 15 mL conical tubes and isolated using an isolation buffer. The supernatant was centrifuged at 500 ×g for 10 min at 4°C and layered onto a discontinuous density gradient. Lysosomes were further isolated via ultracentrifugation (Beckman, Optima XE-100) at 145,000 g for 2 h at 4°C. Lysosomal fractions were extracted from cell homogenates using a lysosome extraction kit (Sigma-Aldrich; LYSISO1). Cell homogenates were centrifuged at 1000 × g for 10 min at 4°C. The supernatant fraction was centrifuged at 20,000 × g for 20 min at 4°C to pellet lysosomes and other organelles. The supernatant was collected as the cytosolic fraction. Pellet fractions were subjected to additional centrifugation. The ultimate pellet, lysosomal fraction, was lysed using the lysis buffer described within the procedure. Samples were then subjected to western blot analysis.

Phos-tag SDS-PAGE

Phosphorylated and non-phosphorylated TRIP-Br1 were analyzed using Phos-tag™ SDS-PAGE gel as described by the manufacturer. Briefly, total cells or mitochondrial samples were prepared with a lysis buffer (20 mM HEPES, 120 mM NaCl, 1% Triton X-100) containing protease inhibitor cocktail. Cell lysates were subjected to 8% SDS-PAGE containing 50 mM Phos-tag acrylamide (Wako Pure Chemical Industries, 30493521) and 20 μM of phos-tag, followed by immunoblotting analysis.

Immunofluorescence and confocal imaging

Cells (5 × 10 4 cells) were grown on a sterilized confocal dish (Coverglass-Bottom Dish, SPL. Cat#100350) for 24 h. Cells were incubated with Mitotracker (Invitrogen, # {"type":"entrez-nucleotide","attrs":{"text":"M22426","term_id":"197107","term_text":"M22426"}} M22426 ) for 30 min and fixed with 4% formaldehyde for 30 min. These cells were then washed with PBS twice and incubated with TRIP-Br1 (Enzo Life Sciences, ALX-804-645) or LC3 (Cell Signaling Technology, #2775S) antibodies overnight at 4°C. These primary antibodies were detected with an anti-mouse IgG H&L (Alexa Fluor® 568) (Abcam, #ab175473) or an anti-rabbit IgG H&L (Alexa Fluor® 488) (Abcam, #ab150077). Nuclei were stained with DAPI (Invitrogen, Cat# {"type":"entrez-protein","attrs":{"text":"P36931","term_id":"82592555"}} P36931 ) for 10 min after washing with PBS. Colocalization between fluorophores was analyzed using ImageJ software (ver. 1.51u; National Institutes of Health, USA). For lysosomal confocal imaging, cells were incubated with 100 nM Lysotracker (Invitrogen, Cat# {"type":"entrez-nucleotide","attrs":{"text":"L12492","term_id":"289562"}} L12492 ) in a phenol-free medium for 90 min. Confocal images were obtained using a Zeiss confocal microscope (Nikon A1 confocal). Image manipulation and merging were performed using appropriate tools of the ImageJ software.

Animal experiment

TRIP-Br1 knockout mice (RRID: MGI:4437096) in a C57BL/6 genetic background were provided by Dr. Huang (Hong Kong University of Science and Technology, Hong Kong, China). Mice strains were genotyped via PCR as described previously 63 . To isolate mouse embryonic fibroblasts (MEFs), embryos were dissected and decapitated from 13.5-day pregnant mice expressing wild-type or knock-out TRIP-Br1. These tissues were washed with cold PBS, cut into pieces, and incubated with trypsin/EDTA. Cells were transferred to DMEM media supplemented with 10 % FBS after each incubation. These cells were maintained in DMEM media after non-adherent cells were removed.

Statistical analysis

Data are presented as mean ± standard deviation (SD) from a minimum of three independent experiments. All statistical analyses were performed using Student's t-test to check two different groups. One-way ANOVA, followed by Bonferroni's multiple comparison was accustomed to compare multiple groups. SPSS statistics version 23 (IBM Corporation, Armonk, NY, USA) was used for all statistical analyses. P < 0.05 indicated statistically significant difference.

Supplementary Material

Supplementary figures.

Acknowledgments

We deeply appreciate Dr. Rikiro Fukunaga (Kyoto University, Japan) for providing U2OS 4.3, a TRIP-Br1-inducible osteosarcoma cell line.

Author Contributions

SJ and DM were responsible for designing the review protocol, conducting the research, extracting and analyzing data, interpreting results, and writing the manuscript. TJ and YC contributed to data extraction of lysosomal fractionation. SL and SH contributed to the development of mitochondrial fractionation and TRIP-Br1 translocation. NTNQ and NHA contributed to the handling of animals for animal experiments. SHV revised the manuscript. MSL made substantial contribution to the conception of the study and the experimental design, revised the manuscript, and gave the final approval for the publication of the manuscript.

This work was supported by the National Research Foundation of Korea (NRF) Grant funded by the Korean Government (No. NRF-2016R1A5A1011974) and the Korea government (Ministry of Science and ICT) (No. NRF-2020R1A2C1102100).

Abbreviations

Featured News
Artificial Intelligence
Bioprocessing
Drug Discovery
Genome Editing
Infectious Diseases
Translational Medicine
Browse Issues
Learning Labs
eBooks/Perspectives
GEN Biotechnology
Re:Gen Open
New Products
Conference Calendar
Get GEN Magazine
Get GEN eNewsletters

Drug Discovery Gains Powerful Single Cell Transcriptional Profiling Tool

Artist’s conception of pathways in the three cancer cell lines studied with sci-Plex. These are not representative of actual data. [Trapnell Lab]

A foundation of the drug discovery process—high throughput screening—is fraught with limitations. A new technique, sci-Plex, uses nuclear hashing to profile and quantify gene expression in single cells in response to thousands of independent perturbations at single-cell resolution. The technology holds promise for drug discovery of drugs for cancer, infection, prenatal medicine, and other research.

“Earlier this year, we reached a point where we could do millions of cells in a single experiment but from a relatively smaller number of different specimens—so, one mouse or one heart or one tumor,” noted Cole Trapnell, PhD, assistant professor at the University of Washington (UW) and senior author on the paper. “Now, with sci-Plex,” Trapnell continued, “we can do millions of cells from thousands or tens of thousands of different specimens.”

The technique is published in Science this week in the paper “ Massively multiplex chemical transcriptomics at single-cell resolution. ”

UW Medicine and Brotman Baty Institute for Precision Medicine researchers describe a new screening technique that obtains gene expression data on hundreds of thousands of individual cells in a treated sample. The technique holds promise in cancer research and in many other diseases or basic science studies [UW Medicine].

Typically, high throughput screens offer either a coarse readout, such as cell survival, proliferation, or alterations in cell shapes, or only a specific molecular finding, such as testing whether a particular enzyme is blocked. Because of the huge gap between those extremes, most assays routinely miss subtle gene expression or cell state changes that might unveil mechanisms triggered inside perturbed cells. Such assays can also fail to detect nuances that might indicate unexpected side effects of drugs being tested, or varying reactions among genetically identical cells to the same drug, or why cells become resistant to treatment that was previously working well.

“This technology actually occupies a niche between the two common kinds of assays,” said one of the lead researchers, Sanjay R. Srivatsan, an MD/PhD student at the University of Washington. “You can get a sort of global view of the cellular responses. We think it’s going to be really powerful to categorize drugs, for example, and say what their mechanism is.”

The new technology combines improvements in labeling cell nuclei with advances in profiling in which genes are expressed in each of millions of cells. This was accomplished at a single-cell resolution and in a cost-effective manner.

“The sci-Plex technique allows us to pool lots of genetically different cells and see what happens to many individual cells as they are perturbed in many different ways,” said Trapnell. “We then collect all the data together and analyze it using modern tools from machine learning and data science to understand something about what each of those drugs does to the cells.”

As a proof of concept, the team applied sci-Plex to a screen using three kinds of cancer cell lines (leukemia, lung cancer, and breast cancer) treated with 188 compounds used for cancer, HIV, and autoimmune disease therapies. The cells were labeled with a nuclear hashing of small, single strands of DNA.

This hashing identifies different cells and permits scientists to map which cells received which drug. In just one experiment, the researchers measured gene expression in 650,000 single cells from more than 5,000 independently treated samples.

The results indicated significant differences in the ways some of the cancer cells reacted to specific compounds. They also revealed shared patterns among cells with regard to other chemical families as well as some properties that distinguished drugs within a chemical family.

The researchers delved more deeply into the mode of action of one class of cancer drugs, HDAC inhibitors. They saw that the gene regulatory changes matched the proposition that these inhibitors stopped cancer cell proliferation by blocking access to an energy source.

Describing another aspect of the research, Srivistan said, “it was really cool that we could use gene expression profiles to categorize the potency of drugs. With changes in dose over four orders of magnitude, we could see a smooth increase in the cellular response.”

Overall, the sci-Plex results suggest that it could be scaled to thousands of samples to target diverse biochemical pathways, catalysts, regulators, and modes of action.

“Some of this work could pertain to the treatment of disease, in helping medical researchers understand how certain drugs produce their effects, how the cell stage influences effectiveness, and why some medications work on some cells, but not on others,” Trapnell said.

“Physicians also give many people the same handful of drugs, and they work for some people and not for others,” Trapnell added. “Potentially sci-Plex could help us better understand why that is.”

Trapnell said he believes sci-Plex could be a useful tool for precision medicine: “Ultimately when someone gets sick with cancer, we want to kill the whole tumor, all of the cells, not just some of the cells. So understanding why some individual cells respond one way to a drug and others respond differently is critical to designing therapies that will be completely effective.”

A distinct advantage of sci-Plex, the researchers noted, is that it can distinguish how a compound affects subsets of cells. In addition to those that make up tumors, such subsets could also include lab-dish living models such as reprogrammed cells, organoids, and synthetic embryos.

The researchers predict that the ease and low cost of nuclear hashing, combined with the flexibility and scalability of their methods for single-cell sequencing, could give sci-Plex many basic research and practical applications in biomedicine. For example, it might help in building a comprehensive atlas of cellular responses to pharmaceutical interventions.

“It’s a very generalizable strategy,” Srivatsan said. “It can be performed with reagents which any scientist can acquire and it can be used in many ways.”

Trapnell agreed. “I’m really interested in how the single-cell genomics scientific community picks this up for things we didn’t anticipate. That happens all the time in our field. Technology developers and experimental biologists are repurposing techniques in all kinds of ways that the original developers did not envision.”

Eww That Smell: Key Basis for BO Production Identified

The effect of ms scan speed on uplc peek separation and....

Leon Schools investigation reveals new details after Lincoln High cheer coaches terminated

Leon County Schools released documents revealing more details from an investigation that determined two Lincoln High School cheer coaches and a volunteer provided alcohol and drugs to minors during an out-of-town trip for a cheerleading competition.

Initially, LCS confirmed that two employees had been fired, but administrative review documents that the Tallahassee Democrat obtained in a public records request show three women were involved — two employees and a volunteer, who were all subsequently released from their coaching duties.

All three of the women were terminated from their coaching positions after they "provided alcohol to students, consumed alcohol while chaperoning and failed to respond appropriately to the safety risk of students who were impaired," according to the documents. The two employees, Precious McDonald and Ke'ana Pennamon, were also fired from their LCS positions.

Attempts to reach the two former employees for comment were unsuccessful, and the volunteer declined to comment on the incident and the investigation.

The incident occurred the weekend of Feb. 8 at a rental home in Orlando where the team was staying for the UCA High School Nationals competition. Documents note that students were also reportedly under the influence of drugs/THC gummies during the trip "without medical attention being pursued for those students."

All three coaches were notified by Lincoln High School Principal Allen Burch on Feb. 16 that they were placed on administrative leave while the incident was under investigation. A week later, each coach was individually interviewed "to discuss and review the incident."

"I have confirmed through interviews that the issue of alcohol possession and use did occur," Burch said in an email to Jimmy Williams, the chief of safety and security staff for LCS. "Additionally, the three coaches confirmed during their interviews the information involving care for intoxicated students."

Pennamon was fired Feb. 23, and McDonald and the volunteer were fired Feb. 27. However, McDonald received an email late afternoon on Feb. 23 informing her that she would be fired from her position as clerical assistant at the high school, and the following morning she responded that she resigned from her position effective immediately.

The situation was internally investigated by LCS and also sent to the Florida Department of Children and Families for further investigation, LCS Spokesperson Chris Petley said.

A DCF spokesperson said they were looking into the matter but had no other information.

Breaking & trending news reporter Elena Barrera can be reached at [email protected] . Follow her on X: @elenabarreraaa .

IMAGES

Drug Trip Stock Photos, Pictures & Royalty-Free Images
psychedelic trip symbols : LSD, weed, skull, eyeball, rainbow, drugs
A Single Psychedelic Drug Trip Can Change Your Personality for Years
Drug Rehab AZ Answers “What is DMT”?
DMT Abuse and Addiction Explained
Overview of computational drug repurposing workflow and drug target

VIDEO

DMT Trip Report: 'The Realization of Love'
Drug trip video production class
Drug Absorption
DYLAN ROSS
“Legalise And Regulate!” Germany Becomes Biggest Country In EU To Decriminalise Cannabis
Children Addicted to Opium

COMMENTS

trippin' Meaning & Origin
In drug slang, a trip is a metaphor for the hallucinatory high produced by LSD, magic mushrooms, and other drugs. The term dates back to the 1920s. When people are tripping on hallucinogenic drugs, they can act very erratic, which probably accounts for the use of trppin' for "acting insane, foolish, or without thinking" in general slang ...
Top 55 Slang For Drugs Urban Dictionary
For example, "He took a tab of acid and had a mind-bending trip.". In a conversation about drug experimentation, someone might say, "I've always been curious about trying acid.". A person sharing their experience might describe, "I took acid at a music festival and the colors and sounds were incredible.". 4. Molly.
Drug trip
drug trip slang A hallucinatory experience caused by a psychedelic drug. I had a really bad drug trip once. I thought I was being chased by man-eating monkeys through a forest made of chocolate! The film's visuals call to mind a prolonged drug trip, a twisted version of reality where strange things are possible. Doctors warn that even a single drug trip ...
Trippin' Meaning: Understanding the Slang Term
Trippin' is a slang term used to describe someone who is acting foolishly or thinking crazy thoughts. It can also refer to someone who is under the influence of drugs, particularly psychedelic drugs like LSD or mushrooms. The origins of the term are somewhat unclear, but it likely comes from the idea of taking a trip, or journey, while on ...
Trippin Meaning: What's the Definition of this Slang Term?
Trippin is a slang term that is often used to describe someone who is acting irrationally, or who is under the influence of hallucinogenic drugs. The term has become popular in recent years, particularly among young people, and is often used in casual conversation. When someone is trippin, they might be acting in a foolish or irrational manner.
A trip
Definition of a trip in the Idioms Dictionary. a trip phrase. What does a trip expression mean? Definitions by the largest Idiom Dictionary. A trip - Idioms by The Free Dictionary. ... slang To have an intense hallucinatory experience as a result of a psychoactive drug. A: "What's wrong with Bill?" B: "He's tripping pretty hard on mushrooms." ...
Psychedelic experience
A psychedelic experience (known colloquially as a trip) is a temporary altered state of consciousness induced by the consumption of a psychedelic substance (most commonly LSD, mescaline, psilocybin mushrooms, or DMT). [citation needed] For example, an acid trip is a psychedelic experience brought on by the use of LSD, while a mushroom trip is a psychedelic experience brought on by the use of ...
rabbit hole Meaning & Origin
Literally, a rabbit hole is what the animal digs for its home. The earliest written record of the phrase dates back to the 17th century. But the figurative rabbit hole begins with Lewis Carroll's 1865 classic, Alice's Adventures in Wonderland. In its opening chapter, "Down the Rabbit-Hole," Alice follows the White Rabbit into his burrow ...
How Does a Writer Put a Drug Trip Into Words? (Published 2018)
Such a metaphor is less a description of anything than an invitation: to imagine a time before time, a point before there was anything at all, before being itself — an invitation, in other words ...
The Curious Case of Curious Alice
In Drug Wonderland, Alice learns about the hard stuff from her new friends the Mad Hatter (LSD), the March Hare (amphetamines), the Dormouse (barbiturates), and the King of Hearts (heroin). The events of Curious Alice play out as an expression of Alice's drug trip. Unfortunately, the trip is kind of fun and effectively cancels out the film ...
trip
The same phrase, to trip, can be used to express the act of releasing a mechanical devise. An example of this, "to trip a switch," means to activate a switch or same mechanical part. To take a trip, the actual action of moving from one place to another and often times acts like a verb. You can go on an ego trip without even leaving your home.
trip
trip in the Drug culture topic by Longman Dictionary of Contemporary English | LDOCE | What you need to know about Drug culture: words, phrases and expressions | Drug culture
Let's Talk About Bad Trips: Separating Difficult from Traumatic
Drug-drug interactions are also often at play during difficult trips, for example, when people combine alcohol with psychedelics. ... Another gift was that my bad trip helped me to better understand, validate, and support others who have been harmed by psychedelics. Another lesson was this: my bad trip was an amplifier of the toxic positivity ...
Trip Killers: How To Stop an Acid Trip
1. Alprazolam (Xanax) Alprazolam is one of the fastest-acting trip killers in the benzodiazepine family — but it's also one of the shortest-lasting. The effects of Xanax, although fast-acting, only last for around four to six hours. Xanax is a favored trip killer among psychonauts purely because of its fast-acting nature.
Trip
Definition of trip in the Idioms Dictionary. trip phrase. What does trip expression mean? Definitions by the largest Idiom Dictionary. Trip - Idioms by The Free Dictionary. ... slang To have an intense hallucinatory experience as a result of a psychoactive drug. A: "What's wrong with Bill?" B: "He's tripping pretty hard on mushrooms." ...
Drug Trip GIFs
drug trip 11,438 GIFs. Sort. Filter
A good trip
Definition of a good trip in the Idioms Dictionary. a good trip phrase. What does a good trip expression mean? Definitions by the largest Idiom Dictionary. ... a good session with LSD or some other drug. (Drugs.) Paul said he had a good trip, but he looks like the devil. 2. n.
Enhancing titres of therapeutic viral vectors using the ...
The apparent titre of HEK293T.TRiP-produced Adeno-CMV-tbsBax-iGFP vector on HeLa cells (1 × 10 6 GFP TU per ml) is believed to reflect the initial burst of expression of both transgenes before ...
The Therapeutic Trip of Melatonin Eye Drops: From the Ocular Surface to
Results showed that in diabetic rat retinas, the leakage of iBRB and the expression of inflammatory factors (VEGF, TNF-α, IL-1β, ICAM-1, and MMP9) increased dramatically, while the expression of tight junction proteins (ZO-1, occludin, JAM-A, and claudin-5) decreased significantly. The above changes were largely ameliorated by melatonin.
Inhibitory role of TRIP-Br1 oncoprotein in anticancer drug-mediated
ROS-triggered TRIP-Br1 translocation into mitochondria and TRIP-Br1-mediated ROS suppression in response to anticancer drug treatment. TRIP-Br1 protein levels in mitochondria after treatment with three different anticancer drugs were analyzed using the MCF7 ... mitochondrial TRIP-Br1 expression was increased following the accumulation of ...
Drug Discovery Gains Powerful Single Cell Transcriptional Profiling Tool
A foundation of the drug discovery process—high throughput screening—is fraught with limitations. ... the researchers measured gene expression in 650,000 single cells from more than 5,000 ...
Lincoln High School cheerleading investigation: Alcohol, drugs involved
Documents show that students were also reportedly under the influence of drugs/THC gummies during the trip "without medical attention being pursed for those students."
Overexpression of TRIP6 promotes tumor proliferation and reverses cell
It is demonstrated that TRIP 6 is reversely correlated with the clinical outcomes of NHL patients and may shed new insights into the important role of TRIP6 in cancer development. Recent studies have identified that thyroid hormone receptor-interacting protein 6 (TRIP6) is implicated in tumorigenesis. However, the functional role of TRIP6 in non-Hodgkin's lymphoma (NHL) has never been ...

Top 55 Slang For Drugs Urban Dictionary – Meaning & Usage

19. Molly water

21. Mary Jane

25. Acid tabs

26. Xannies

32. Molly rocks

34. Speedball

35. Crystal

36. Dope fiend

44. Zannies

You may also like

Slang dictionary

Where does rabbit hole come from?

Examples of rabbit hole

Other categories

How Does a Writer Put a Drug Trip Into Words?

Explore More in Books

The Curious Case of Curious Alice

Share this:

Let’s Talk About Bad Trips: Separating Difficult from Traumatic

Myth: Bad Trips Only Happen When the Set and Setting Are Improper

The Influence of Neuroticism

Myth: Bad Trips Are Actually Just Difficult Experiences That Haven’t Been Integrated

Myth: There’s No Such Thing as Bad

Myth: Talking About Bad Trips Is Going to Harm the Psychedelic Movement

How to Talk to a Bad Trip Survivor

Healing From My Bad Trip

Follow your Curiosity

You may also be interested in:

Mental Health

Self-Discovery

Harm Reduction

Trip Killers: How To Stop an Acid Trip

What Are Trip Killers?

Top 7 Trip Killers

How Do Trip Killers Work?

When Do Trip Killers NOT Work?

When Should You Use a Trip Killer?

What To Expect When You “Kill” a Trip

Safety Aspects to Consider When Using Trip Killers

How To Minimize the Risk of a Bad Trip

How to Make DMT: 3 Separate Methods (N,N,DMT & 5-MeO-DMT)

Can Psychedelics Help With Problem Solving?

The Mind’s Theatre: Psychedelics & Dreams

How to Make Ayahuasca: Step-by-Step Guide

Where Does Ketamine Come from?

GIPHY Clips

Enhancing titres of therapeutic viral vectors using the transgene repression in vector production (TRiP) system

Similar content being viewed by others

Synthetic virology approaches to improve the safety and efficacy of oncolytic virus therapies

Stable expression of large transgenes via the knock-in of an integrase-deficient lentivirus

Self-attenuating adenovirus enables production of recombinant adeno-associated virus for high manufacturing yield without contamination

TRAP blocks single- or multi-cistronic mRNA translation

Enhanced lentiviral vector titres using the TRiPLenti system

Improved protein profiles of TRiPLenti vectors encoding COX2

Recovery of DNA-based vectors expressing an apoptotic gene

Lentiviral vector production

Adenoviral vector production

Assays for measuring transgene expression

Detection of cytoplasmic GFP RNA copy-number by qRT-PCR

Viral vector titration assays

Protein analysis of EIAV-based vectors by SINQ

Statistical analysis

Data availability

Additional information

Acknowledgements

Author information

Authors and Affiliations

Contributions

Corresponding author

Ethics declarations

Supplementary information

Peer Review File (PDF 623 kb)

About this article

Share this article

Quick links

Inhibitory role of TRIP-Br1 oncoprotein in anticancer drug-mediated programmed cell death via mitophagy activation

Introduction

Mitochondrial distribution/sub-localization of TRIP-Br1 protein in normal breast and cancer cell lines

ROS-triggered TRIP-Br1 translocation into mitochondria and TRIP-Br1-mediated ROS suppression in response to anticancer drug treatment